The efficacy of Allium ampeloprasum L. in reducing neutrophil recovery time in childhood cancer with febrile neutropenia: a randomized, double-blind, placebo-controlled trial.

INTRODUCTION: Febrile neutropenia is a serious complication of cancer chemotherapy that can result in delays in treatment. This study evaluates the efficacy of A. ampeloprasum L. at neutrophil recovery time in children with chemotherapy-associated febrile neutropenia. METHODS: This single-center, parallel-group, double-blind, randomized clinical trial was conducted at an oncology hospital. Patients selected among childhood cancers with febrile neutropenia. Overall, 97 febrile neutropenic children were enrolled. The intervention group (n=49) was given A. ampeloprasum L. in capsules (500 mg twice daily) for seven days plus supportive care. The control group (n=48) was treated similarly with supportive care and placebo capsules. Total white blood cell (WBC) and absolute neutrophil counts (ANC) were checked daily and neutrophil recovery time in both groups was compared. RESULTS: Patients in the intervention group experienced shorter neutrophil recovery compared to the control group (4.02 ± 2.32 days vs. 6.38 ± 2.80 days, respectively, P less than 0.001). The intervention group was discharged from the hospital earlier than the control group with a mean of two days, but it did not reach statistical significance (P=0.133). Mean WBC and ANC were not significantly different in the two groups. Herbal medicine was well tolerated, and no adverse effect was reported. CONCLUSIONS: A fresh, lyophilized extract from deciduous leaves of A. ampeloprasum L. can effectively shorten the ANC recovery time leading to an earlier release from the hospital. The trial was registered in the Iranian Registry of Clinical Trials with registration No. IRCT2015051615666N2 (http://www.irct.ir/).

Cardioprotective effects of deferoxamine in acute and subacute cardiotoxicities of doxorubicin: a randomized clinical trial.

BACKGROUND: Cardiotoxicity is a major concern following doxorubicin (DOX) use in the treatment of malignancies. We aimed to investigate whether deferoxamine (DFO) can prevent acute cardiotoxicity in children with cancer who were treated with DOX as part of their chemotherapy. RESULTS: Sixty-two newly-diagnosed pediatric cancer patients aged 2-18 years with DOX as part of their treatment regimens were assigned to three groups: group 1 (no intervention, n = 21), group II (Deferoxamine (DFO) 10 times DOX dose, n = 20), and group III (DFO 50 mg/kg, n = 21). Patients in the intervention groups were pretreated with DFO 8-h intravenous infusion in each chemotherapy course during and after completion of DOX infusion. Conventional and tissue Doppler echocardiography, serum concentrations of human brain natriuretic peptide (BNP), and cardiac troponin I (cTnI) were checked after the last course of chemotherapy. Sixty patients were analyzed. The level of cTnI was < 0.01 in all patients. Serum BNP was significantly lower in group 3 compared to control subjects (P = 0.036). No significant differences were observed in the parameters of Doppler echocardiography. Significant lower values of tissue Doppler late diastolic velocity at the lateral annulus of the tricuspid valve were noticed in group 3 in comparison with controls. By using Pearson analysis, tissue Doppler systolic velocity of the septum showed a marginally significant negative correlation with DOX dose (P = 0.05, r = - 0.308). No adverse effect was reported in the intervention groups. CONCLUSIONS: High-dose DFO (50 mg/kg) may serve as a promising cardioprotective agent at least at the molecular level in cancer patients treated with DOX. Further multicenter trials with longer follow-ups are needed to investigate its protective role in delayed DOX-induced cardiac damage. Trial registration IRCT, IRCT2016080615666N5. Registered 6 September 2016, http://www.irct.ir/IRCT2016080615666N5 .

The survival of childhood leukemia: An 8-year single-center experience.

BACKGROUND: The survival of childhood leukemia has improved. We aimed to report the survival rate and the associated factors in children with acute leukemia during an 8-year follow-up. AIMS: This study investigates the 8-year survival rates of children with acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) in Shiraz, the largest oncology center in Southern Iran. We also aimed to assess the independent factors associated with higher mortality in childhood leukemia. METHODS: Children 0-18 years with acute leukemia were followed from 2013 to 2021 in Shiraz, Iran. The 8-year overall survival (OS) and event-free survival (EFS) rates were estimated by the Kaplan-Meier method. Independent factors associated with survival were assessed by the Cox regression hazard modeling. RESULTS: We included 786 children, with 43.5% female, and a mean age of 6.32 ± 4.62 years. Patients with AML compared to ALL experienced more relapse (34.6% vs. 22.5%, p = .01) and death (31.7% vs. 11.3%, p < .001). The cumulative 8-year OS and EFS were 81% (95% confidence interval (CI), 74.3% to 86.1%) and 68.3% (95% CI, 63.5% to 72.7%) in ALL patients and 63.5% (95% CI, 52.1% to 72.9%) and 43% (95% CI, 33.1% to 52.6%) in AML patients. Multivariable analysis revealed that hepatomegaly (hazard ratio = 4, 95% CI, 1.0 to 22.3, p = .05) was the main independent risk factor of death in ALL patients. No definite risk factor was defined for AML patients. CONCLUSION: The survival of childhood leukemia has recently increased dramatically in low-middle income countries. Hepatomegaly was introduced as a potential risk factor for lower survival in ALL patients. Further multicenter studies are needed to confirm the validity of this association.

Comparative Effectiveness of Peg-Asparaginase and L-Asparaginase on Coagulation Markers Among Pediatric Patients with Acute Lymphoblastic Leukemia.

BACKGROUND: Asparaginase (ASP), a chemotherapy component in the acute lymphoblastic leukemia (ALL) treatment, could impair normal coagulation state. Usually, a decline in the levels of several coagulation factors occurs which ultimately could lead to thrombotic events and abnormal coagulation tests. In this study, we aimed to compare the effects of two different subtypes of ASP, pegylated asparaginase (PEG-ASP) and L-asparaginase (L-ASP) on coagulation markers and test among 40 pediatric patients with ALL. METHODS: In this cohort study a total of 40 pediatric patients with newly diagnosed ALL were enrolled and divided into two groups by simple randomization. In group A, 20 patients received PEG-ASP while in group B, 20 patients received L-ASP during the induction treatment. Coagulation markers included prothrombin time (PT), partial thrombin time (PTT), protein-C (Pr-C), protein-S (Pr-S), and antithrombin III (ATIII) and were assessed before start and after of induction chemotherapy. RESULTS: Coagulation profile including PT, PTT, INR, Pr-C, Pr-S, and ATIII before start of treatment were not statistically significant between the two groups. Anticoagulant factors decreased significantly after consuming both drugs. Tests for PT and INR of those who took L-ASP decreased significantly. Overall, when comparing the changes of the six studied factors, ATIII and Pr-C were the significant factors which were different between groups. CONCLUSIONS: ASP has a negative effect on anticoagulant factors including (ATIII, Pr-C, Pr-S). Additionally, the negative effect of L-ASP on anticoagulant factors was more prominent than PEG-ASP. Therefore, the risk of thrombosis probably was negligible in PEG-ASP in comparison with L-ASP.

The Outcome of Children With Malignant Bone Tumors: A Single-Center Experience.

Malignant bone tumors (MBT) account for 3% to 5% of cancers in children younger than 15 years. We aimed to report the outcome of children with MBT in 10 years in Southern Iran. During the study period, 100 patients (57 Osteosarcoma, 43 Ewing sarcoma) with an M/F ratio of 1.56 and a median age of 13.8 years (3.8-17.9) were diagnosed. Metastasis occurred in 27% of patients, mostly in the first 3 months of diagnosis. The mean survival time of MBT altogether was 94.1 months (95% CI: 86.5-101.7). The 5-year overall survival and event-free survivals were 85.2% (95% CI: 74%-91.8%) and 69.2% (95% CI: 56%-79%), respectively. Metastasis was the only independent risk factor of death in our study cohort (Hazard ratio 36.7, 95% CI: 4.8-282.6, P = .001) MBT in children mostly occur in adolescent boys. About one-third of them become metastatic, which is significantly associated with poor outcomes.

Comparison of the clinical features and outcome of children with hemophagocytic lymphohistiocytosis (HLH) secondary to visceral leishmaniasis and primary HLH: a single-center study.

BACKGROUND: Hemophagocytic lymphohistiocytosis (HLH) is a syndrome of excessive inflammation. We aimed to describe the clinical and laboratory findings of HLH patients secondary to Visceral leishmaniasis (VL) and their treatment outcome during a 4-year follow-up period compared to primary HLH. METHOD: Forty children with primary HLH confirmed by genetic study and 20 children with HLH secondary to VL confirmed by a blood or bone marrow polymerase chain reaction from 2014 to 2018 in Shiraz, Fars province, Southern Iran, were enrolled. RESULTS: The median age at diagnosis was 11.5 months (range 1-170), and 56.7% were male. Fever and splenomegaly were the most frequent clinical presentations. 93.3% of the subjects had an HScore > 169, which had a good correlation with HLH-2004 criteria (r = 0.371, P = 0.004). Patients with primary HLH experienced more thrombocytopenia (P = 0.012) and higher alanine transaminase (P = 0.016), while patients with VL-associated HLH had higher ferritin (P = 0.034) and erythrocyte sedimentation rate (P = 0.011). Central nervous system (CNS) involvement occurred in 38.3% of patients. The mortality rate was higher in patients with CNS disease (61% vs. 35%, P = 0.051). The 3-yr overall survival rate was 35.9%. (24% in primary HLH and 100% in VL-associated HLH, P < 0.001). In Cox regression analysis, platelet count < 100,000/ µ l (hazard ratio 4.472, 95% confidence interval 1.324-15.107, P = 0.016) correlated with increased mortality in patients with primary HLH. CONCLUSION: VL is a potential source of secondary HLH in regions with high endemicity. Treatment of the underlying disease in VL-associated HLH is sufficient in most cases, with no need to start etoposide-based chemotherapy.

Feasibility and Therapeutic Potential of Combined Peptide Receptor Radionuclide Therapy With Intensive Chemotherapy for Pediatric Patients With Relapsed or Refractory Metastatic Neuroblastoma.

BACKGROUND: Recent evidence has demonstrated high expression of somatostatin receptors in neuroblastoma (NB) cells. Because of this, we endeavored to evaluate the diagnostic performance and clinical efficacy of 68Ga-DOTATATE PET/CT and peptide receptor radionuclide therapy (PRRT) using 177Lu-DOTATATE combined with chemotherapy in pediatric NB patients. PATIENTS AND METHODS: In total, 14 pediatric patients with histopathologically confirmed NB underwent 68Ga-DOTATATE PET/CT. Among them, the patients who were refractory or relapsed after therapy with 131I-MIBG and had intensive uptake of 68Ga-DOTATATE were referred for PRRT using 177Lu-DOTATATE. Treatment response based on follow-up imaging was classified into complete response, partial response, stable disease, and progressive disease. After each cycle of PRRT, laboratory tests were performed for evaluation of hematological, renal, and hepatic toxicities. The CTCAE (Common Terminology Criteria for Adverse Events; version 4.03) was used for grading adverse event. Curie score and International Society of Pediatric Oncology Europe Neuroblastoma score were used for semiquantitative analysis of scans of patients who underwent PRRT. In addition, overall survival was calculated as the time interval between the date of the first cycle and the end of follow-up or death. RESULTS: Overall, 14 refractory NB children including 7 boys and 7 girls with a median age of 5.5 years (ranged from 4 to 9) underwent 68Ga-DOTATATE PET/CT. PET/CT was positive in 10/14 patients (71.4%), and the median number of detected lesions in positive patients was 2 (range, 1-13). Of 14 patients, 5 patients underwent PRRT, including 3 boys and 2 girls. A total of 19 PRRT cycles and 66.4 GBq 177Lu-DOTATATE were given. Among these 5 patients, 2 showed an initial complete response, which relapsed a few months later, 1 showed a partial response, and 2 showed progressive disease. According to the Kaplan-Meier test, the overall survival was estimated at 14.5 months (95% confidence interval, 8.9-20.1). In evaluation of PRRT-related toxicity according to the CTCAE, 4 patients showed grade 1, and 1 showed grade 2 leukopenia. Two patients showed grade 1, and 2 others showed grade 2 anemia. Two patients showed grade 1, and 3 patients showed grade 2 thrombocytopenia. Serum creatinine in 1 patient increased to grade 1. CONCLUSIONS: Combination of 177Lu-DOTATATE with chemotherapeutic agents might achieve worthwhile responses with low toxicity, encouraging survival in NB patients who have relapsed or are refractory to conventional therapy, including 131I-MIBG therapy. Imaging with 68Ga-DOTATATE PET/CT in such patients has a relatively high detection efficacy, demonstrating its potential use as an alternative imaging tool to conventional modalities such as 123I/131I-MIBG. However, further well-designed trials are highly warranted.

Bayesian spatial modeling of transfusion-dependent ß-thalassemia incidence rate in Fars Province, Southern Iran.

BACKGROUND: Using maps and spatial analysis are technologies to evaluate the magnitude and spatial distribution of disease in epidemiology investigations. We aimed to conduct a Bayesian spatial analysis on epidemiologic data of transfusion-dependent ß-thalassemia (TDT) patients. METHODS: In this cross-sectional study, data of all TDT patients diagnosed during 1955-2018 in all counties of Fars Province were obtained from data registry of the Organization of Special Diseases of Shiraz University of Medical Sciences in Shiraz, Fars Province, Iran. Besag, York, and Mollie's (BYM) model was used for mapping. RESULTS: The estimated relative risk ranged from 0.23 to 1.66 for TDT patients. The highest and lowest relative risks of TDT were observed in Larestan located in Southern and Abadeh in Northern Fars Province respectively. CONCLUSIONS: Determining the accurate geographical distribution of a chronic disease such as ß-thalassemia can be an essential prerequisite in allocation of regional health system resources.

Effects of three months of treatment with vitamin E and N-acetyl cysteine on the oxidative balance in patients with transfusion-dependent ß-thalassemia.

Oxidative stress is a major mechanism contributing to the progression of ß-thalassemia. To assess the effect of vitamin E and N-acetyl cysteine (NAC) as antioxidant agents on total oxidative stress (TOS) status and total antioxidant capacity (TAC) in patients with transfusion-dependent ß-thalassemia (TDT). In this open-label randomized controlled trial, from May to August 2019, 78 eligible patients with TDT over the age of 18 were enrolled. All patients were registered at the Thalassemia Clinic of Shiraz University of Medical Sciences in Southern Iran. Patients were randomly allocated to the NAC group (10 mg/kg/day, orally), vitamin E group (10 U/kg/day, orally), and control group. The duration of the study was 3 months. The mean age of the participants was 28.5 ± 5.1 (range: 18-41) years. At the end of the study, TOS significantly decreased only in the vitamin E group (mean difference (MD), 95% confidence interval (CI): 0.27 (0.03-0.50), P = 0.026). TAC significantly decreased in both supplemented groups at the 3rd month of treatment (NAC group: MD (95% CI): 0.11 (0.04-0.18), P = 0.002 and vitamin E group: 0.09 (0.01-0.16), P = 0.022 respectively). Hemoglobin did not significantly change at the end of the study in each group (P > 0.05). Mild transient adverse events occurred in 4 patients of the NAC group and 5 patients of the vitamin E group with no need to discontinue the treatment. Vitamin E can be a safe and effective supplement in improving oxidative stress in patients with TDT. Moreover, it seems that a longer duration of using antioxidant supplements needs to make clinical hematologic improvement in TDT patients.

Ocular findings in patients with transfusion-dependent ß-thalassemia in southern Iran.

BACKGROUND: Ocular involvement may occur via several mechanisms in patients with transfusion-dependent ß-thalassemia (TDT) mainly chronic anemia, iron overload and iron chelator toxicity. We aimed to evaluate the frequency of abnormal ocular findings and their relationship with hematologic parameters in TDT patients. METHODS: In this cross-sectional study from January 2018 to January 2019, a total of 79 patients with TDT over the age of 18 who were on iron-chelation therapy (ICT) were consecutively investigated. All patients were registered at the Thalassemia Comprehensive Center affiliated with Shiraz University of Medical Sciences, Shiraz, Southern Iran. Complete ophthalmic examination was performed by an expert ophthalmologist. Clinical and hematologic parameters were collected from the patients´ medical records. RESULTS: The mean age ± standard deviation (SD) of the patients was 28.4 ± 5.6 years (range: 18-43). Twenty-four patients (30.4%) were male and 29 (36.7%) were splenectomized. The mean ± SD of the best-corrected visual acuity (VA) was 0.960 ± 0.086 decimal, (range: 0.6-1), 0.016 ± 0.046 logMar, (range: 0-0.2). The frequency of patients with VA > 0.1 logMar was 3 (3.8%). The mean intraocular pressure (IOP) was 14.88 ± 3.34 (6-25) mmHg. Fundus abnormalities were observed in 8 patients (10.1%), consisting of increased cup-disk ratio (3.8%), vessel tortuosity (2.5%), retinal pigment epithelium degeneration (2.5%), myelinated nerve fiber layer (1.3%), and internal limiting membrane wrinkling (1.3%). No significant association was observed between fundus abnormalities, VA, or IOP with hematologic parameters (P > 0.05). TDT patients with diabetes mellitus had significantly higher IOP (P = 0.010) but similar frequency of fundus abnormalities with non-diabetic patients (P > 0.05). CONCLUSIONS: The frequency of ocular abnormalities in our patients was lower than the previous reports. The frequency of fundus abnormalities were similar in diabetic and non-diabetic thalassemia patients indicating close monitoring and proper management of the disease and comorbidities in these patients.

Cellular mesoblastic nephroma in infants and children: Report of four cases and review of the literature.

BACKGROUND: Cellular mesoblastic nephroma is rare after infancy, and there are many controversial reports about its clinical presentation and treatment as well as outcome in infants, young children, and adolescents. OBJECTIVES: In this report, we will discuss our experience with four cases of cellular mesoblastic nephroma presented from infancy to childhood (from 18 months of age to 11 years of age). CASES: During 10 years, we had the experience of 4 cases of pediatric renal tumor with the diagnosis of cellular mesoblastic nephroma, which have been followed between 1 year and 6 years. There were three male and one female patients with the age of 1.5, 2, 2, and 11 years. These tumors showed variable characteristics according to the number of mitosis, proliferative rate, necrosis, immunohistochemical markers, and metastatic potential; however, despite of all of these variabilities, all of these patients have done well and all have been well at the end of study. CONCLUSION: Pediatric renal tumors with the histologic diagnosis of cellular mesoblastic nephroma have good outcome even with metastasis, mitosis, and high proliferative rate.

Successful treatment of refractory metastatic neuroblastoma with panobinostat in combination with chemotherapy agents and iodine-131-meta-iodobenzylguanidine therapy.

INTRODUCTION: Neuroblastoma commonly required multimodal therapy containing surgery, chemotherapy, radiotherapy, and immunotherapy. CASE REPORT: In our case, who had refractory metastatic neuroblastoma, we use histone deacetylase inhibitor (panobinostat) in combination with chemotherapy agents and iodine-131-meta-iodobenzylguanidine (MIBG) therapy. MANAGEMENT AND OUTCOME: This approach leads to successfully treat the patient. MIBG scan and bone marrow examination after therapy revealed no evidence of tumor. Now, she underwent autologous transplantation six months ago and free of tumor. CONCLUSION: Panobinostat can cause apoptosis induction in refractory metastatic neuroblastoma in combination with MIBG therapy and chemotherapy.

A novel frame-shift deletion in FANCF gene causing autosomal recessive Fanconi anemia: a case report.

BACKGROUND: Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by congenital anomalies, early-onset bone marrow failure, and a high predisposition to cancers. Up to know, different genes involved in the DNA repair pathway, mainly FANCA genes, have been identified to be affected in patients with FA. CASE PRESENTATION: Here, we report clinical, laboratory and genetic findings in a 3.5-year-old Iranian female patient, a product of a consanguineous marriage, who was suspicious of FA, observed with short stature, microcephaly, skin hyperpigmentation, anemia, thrombocytopenia and hypo cellular bone marrow. Therefore, Next Generation Sequencing was performed to identify the genetic cause of the disease in this patient. Results revealed a novel, private, homozygous frameshift mutation in the FANCF gene (NM_022725: c. 534delG, p. G178 fs) which was confirmed by Sanger sequencing in the proband. CONCLUSION: Such studies may help uncover the exact pathomechanisms of this disorder and establish the genotype-phenotype correlations by identification of more mutations in this gene. It is the first report of a mutation in the FANCF gene in Iranian patients with Fanconi anemia. This new mutation correlates with a hematological problem (pancytopenia), short stature, and microcephaly and skin hyperpigmentation. Until now, no evidence of malignancy was detected.

Expression of antiapoptotic proteins livin and survivin in pediatric AML patients, as prognostic markers.

OBJECTIVE: Survivin and livin are highly expressed in various malignancies and their expression levels may be related to unfavorable prognosis. The aim was to investigate the relationships of these two markers with some prognostic factors and with survival of the children with acute myeloid leukemia (AML). METHODS: Livin and survivin expression was investigated quantitatively by immunohistochemistry staining technique in 43 primary formalin-fixed, paraffin-embedded bone marrow blocks in pediatric age group (<18 years). RESULTS: Both survivin and livin were expressed in 81.4% of AML patients. Livin expression showed significant positive association with high level of primary WBC (p = .002). Survivin expression showed significant positive correlations with risk of relapse (p ≤ .001) and high level of primary WBC (p = .003). The relationship of overall survival (OS) of the patients with livin and survivin expression, were investigated separately in disease subtypes. Significant association was observed between survivin expression and shorter OS regardless of subtypes including acute promyelocytic (APL) (p = .01) and nonacute promyelocytic leukemia (non-APL) (p = .008). Also, significant association of livin expression with shorter OS was detected, but only in APL subgroup (p = .046). Nevertheless, in Cox regression model after adjusting for disease subtypes, stage and cytogenetics; survivin and livin showed no significant association with OS (p > .05). CONCLUSION: Livin and survivin showed significant associations with some poor prognostic factors of AML. Although survivin in both subtypes and livin in non APL subtype, showed a significant relationship with shorter OS, none of them was determined as independent prognostic factors. Further studies with larger sample size are suggested.

Acute Progressive Visual Loss in a Case of Acute Myeloid Leukemia: Challenges in the Utility of Molecular Tests in Early Diagnose of Cytomegalovirus Retinitis.

Cytomegalovirus (CMV) retinitis is one of the rare but debilitating presentations of the CMV infection in children with leukemia. Herein, we report a 12-year-old boy with acute myeloid leukemia complicated by rapid progressive visual loss during relapse of leukemia. The definite diagnosis of CMV retinitis was made after vitreous aspiration. Despite prompt treatment and ophthalmologic intervention, he died because of AML relapse. Viral infections, especially cytomegalovirus infection, may present with vague clinical pictures during any time of chemotherapy, which may not be easily distinguishable from bacterial or fungal retinitis and also chemotherapy-induced retinopathies. Clinician should consider CMV retinitis in seropositive patients especially those without detectable viremia.

Evaluation of Metabolic Syndrome and Related Factors in Children Affected by Acute Lymphoblastic Leukemia.

INTRODUCTION: Obesity is among the medical problems in survivors of childhood acute lymphoblastic leukemia (ALL). These patients are at risk of metabolic syndrome (MS). The present study aimed to follow the patients with ALL regarding the incidence of MS. PATIENTS AND METHODS: This study was conducted on all patients who referred to the oncology clinic from July 2012 to July 2013. The exclusion criteria of the study were ALL relapse, secondary malignancy, hypothyroidism, Down syndrome, and below 2 years of age. ALL had to be diagnosed at least 12 months before enrollment into this study. MS was assessed by serum triglyceride, cholesterol, fasting blood sugar, leptin, and insulin levels. Besides, body mass index (BMI) and blood pressure (BP) were measured at diagnosis and at the last visit. RESULTS: This study was conducted on 53 patients (male = 35, female = 18). At the end of the study, 13 patients (24.53%) were overweight compared to 3 patients at diagnosis (P = 0.04). The mean blood leptin level was higher in overweight patients compared to the others (P = 0.001). MS was detected in 21 patients (39.6%), including 12 males and 9 females. In addition, the BMI Z-score significantly increased over the study period (P = 0.001). CONCLUSIONS: Being overweight is a complication of ALL treatment, which is associated with elevated blood leptin level and BMI Z-score. Therefore, MS criteria, such as BP, weight, and serum triglyceride level, should be taken into account in each visit.

A cross-sectional study of complementary and alternative medicine use in patients with coagulation disorders in Southern Iran.

OBJECTIVE: Complementary and alternative medicine (CAM) use has an increasing trend around the world. Despite the wild application of CAM in patients with coagulation disorders, its efficacy is still questioned by many studies. The aim of this study was to determine the frequency and types of CAM usage, and the factors affecting CAM use among patients with bleeding disorders. METHODS: This cross-sectional study investigated the usage of CAM with a standard validated questionnaire in coagulopathic patients who were referred to Dastgheib Hospital, an educational therapeutic center affiliated to the Shiraz University of Medical Sciences in Shiraz, Southern Iran. RESULTS: Between December 2015 and May 2016, 75 patients were included in this survey. Severe hemophilia A and rare bleeding disorders were the most frequent among our participants. Overall, nearly half of the studied population (49.3%) used at least one CAM product or practices. The most common products were multivitamin (29.3%), followed by folic acid (21.3%) and chamomile (12%). 32% of the patients resorted to faith healing. The main reasons of using CAM were reported to be increased general health, correction of anemia and thrombocytopenia and control of bleeding tendency. CONCLUSION: CAM is being used frequently in patients with coagulation disorders like many other chronic illnesses all around the world. Due to emerging concern regarding the safety and possible interaction with the conventional medicine, it is necessary to develop basic data about the hematologic effects of these methods in order to use them more safely.

Interleukin-23 Receptor Gene Variants in Acute Lymphoblastic Leukemia and Their Relation to Prognostic Factors.

BACKGROUND: Interleukin (IL)-23 has an important role in tumor immune regulation. OBJECTIVE: To investigate the possible association of interleukin-23 receptor (IL23R) gene variants rs1884444, rs10889677 and rs11209026 with development of acute lymphoblastic leukemia (ALL). METHODS: The IL23R variants were studied in 164 ALL patients and compared to 175 healthy controls by polymerase chain reaction-restriction fragment length polymorphism. The relationship between these variants and clinical and laboratory features of the patients and response to therapy were evaluated. RESULTS: No significant differences in genotype and allele frequencies existed between patients and controls. The rs1884444TG genotype was significantly lower in patients who relapsed (24.2%) compared to those without relapse (55.9%, p=0.006). Fewer patients who relapsed had evidence of the G allele (p=0.034). The TG genotype was associated with a longer complete remission at 1804±116 days compared to other genotypes (<1217 days, p=0.028), however, this result was not significant in multivariate analysis. The rs10889677 AA genotype and A allele were associated with age (p<0.041) and platelet number (p=0.03) in precursor-B cell ALL (B-ALL) patients. Both occurred more frequently in patients aged 2-10 years (63.6% and 66%, respectively) and in those with platelets >100×10ˆ3 µL (68.4% and 52.4%, respectively). CONCLUSION: Our findings showed a lack of association of the studied polymorphisms with the risk of ALL. The influence of the rs1884444 polymorphism on relapse rate and association of rs10889677 AA genotype with favorable prognostic factors suggest the effect of the studied polymorphisms on ALL response to therapy and prognosis.

Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype.

OBJECTIVE AND IMPORTANCE: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or ß-globin gene clusters. The aim of this report was to present a new insertional mutation in the α1 globin gene which causes transfusion-dependent anemia in α-thalassemic patients. CLINICAL PRESENTATION: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14-21 days. INTERVENTION: Sequencing of the ß-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α1-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A1 mutation. MED deletion was detected by gap-PCR. CONCLUSION: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like ß-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.

Comparison Effect of Intravenous Ketamine with Pethidine for Analgesia and Sedation during Bone Marrow Procedures in Oncologic Children: A Randomized, Double-Blinded, Crossover Trial.

Background: Children suffering from cancer always require pain relief and reduce anxiety when undergoing painful procedures. The aim of this study is to compare the effect of pethedine and ketamine administration in cancer-diagnosed children undergoing bone marrow aspiration and biopsy procedures. Subjects and Methods: A randomized, double-blinded, crossover trial was carried out on 57 children undergoing painful procedures (bone marrow aspiration/biopsy). Patients were randomly assigned in a double-blinded fashion to receive either intravenous pethedine (1 mg/kg/dose) or ketamine (1 mg/kg/dose), respectively. The effectiveness of the drug was measured utilizing three parameters; perception of procedural pain with Wong-Baker Faces Pain Rating Scale and Richmond Agitation-Sedation Scale (RASS), hemodynamic changes and respiration and the frequency of vomiting nausea score. Results: Additionally, hemodynamic stability and pain control were significantly better in the patients receiving ketamine (p<0.05, at 0, 15, 30 min). Nausea and vomiting were more frequent in Group K than in Group M but there were no significant differences. No serious complications were observed. Conclusion: This study showed that intravenous ketamine generated a superior clinical effect in decreased pain. Ketamine may also be recommended as a reasonable option before oncology procedures in children suffering from cancer.