RESUMO
The 2019 novel coronavirus, SARS-CoV-2, was highly prevalent in China as of December 2022, causing a range of symptoms, predominantly affecting the respiratory tract. While SARS-CoV-2 infection in children is generally mild, severe cases, especially in infants, are rare. We present a case of a previously healthy 7-month-old infant who developed cerebral infarction and coagulation dysfunction three days after COVID-19 onset. Clinically, the infant had weakness in the left limbs and pinpoint bleeding spots. A cranial magnetic resonance imaging showed ischemic strokes in the right basal ganglia and thalamus. Laboratory tests indicated thrombocytopenia and coagulation dysfunction. Inflammatory cytokines like interleukin-10 were elevated, with increased CD3+, CD4+, and CD8+ T lymphocytes but decreased CD3- CD16+ CD56+ natural killer cells. Treatment included mannitol, dexamethasone, oral aspirin, and vitamins B1 and B6 for reducing intracranial pressure, antiinflammation, anticoagulation, and nerve support, respectively. During the recovery phase, rehabilitation therapy focused on strength training, fine motor skills, and massage therapy. The infant gradually improved and successfully recovered. While rare, such cases can lead to severe complications. These combined efforts were instrumental in achieving significant functional recovery in the patient, demonstrating that even in severe instances of pediatric cerebral infarction due to COVID-19, positive outcomes are attainable with early and comprehensive medical response.
Assuntos
Transtornos da Coagulação Sanguínea , COVID-19 , Lactente , Humanos , Criança , COVID-19/complicações , SARS-CoV-2 , Citocinas , Infarto Cerebral/etiologiaRESUMO
The modification of the physicochemical properties of sulfonated poly(arylene ether nitrile) (SPAEN) proton exchange membranes was demonstrated by poly(ethylene-co-vinyl alcohol) (EVOH) doping (named SPAEN-x%). By controlling the temperature during membrane preparation, the side reactions of the sulfonic acid groups to form sulfonic acid esters were effectively prevented, greatly reducing the proton conductivity of the membranes. Due to the flexible chain of EVOH, SPAEN-8% showed a relatively high elongation of 30.2%, which enhanced the aromatic polymers' flexibility. The SPAEN-2% membrane exhibited proton conductivity of 166, 55, and 9.6 mS cm-1 at 95%, 70%, and 50% relative humidity, respectively, higher than those of the other SPAEN-x% membranes and even comparable to that of Nafion 212. The water uptake, morphological study, and through-plane proton conductivity of the membranes were studied and discussed. The results suggest that EVOH doping can be used as an effective strategy to improve SPAEN-based proton exchange membranes' performance.
RESUMO
The energy crisis and environmental issues are becoming more severe due to the long-term consumption of fossil fuels. Therefore, novel energy-conversion devices with high energy density and environmental friendliness are expected to provide reliable alternatives to traditional fossil-based energy systems. However, because of the inevitable use of costly precious metals as the electrode catalysts for such devices, their popularization is seriously hindered. Transition metal nitrides (TMNs) exhibit similar surface and adsorption properties to noble metals because the atomic distance between metal atoms increases and the d-band center of metal atoms downshifts after nitrogen atoms enter the metal lattice. TMNs have become one of the best electrode materials to replace noble metal-based electrocatalysts in next-generation energy-storage and energy-conversion devices. In this review, the recent developments in the electrocatalytic application of TMNs are covered. First, we discuss the structure and activity origin of TMNs and introduce the common synthesis methods for the preparation of TMNs. Subsequently, we illustrate the applications of mono-metallic TMNs and multi-metallic TMNs in oxygen-reduction reaction, oxygen-evolution reaction, and bifunctional oxygen reduction and evolution reactions. Finally, we summarize the challenges of TMNs encountered at the present stage, and expect their future development.
RESUMO
OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION: The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Assuntos
Transtorno Autístico , Deficiências do Desenvolvimento , Transtorno Autístico/genética , Criança , Feminino , Humanos , Mutação , Estudos Retrospectivos , Síndrome , Fatores de Transcrição/genéticaRESUMO
We report that non-contact self-referencing temperature sensors can be realized with the use of core-shell nanostructures. These lanthanide-based nanothermometers (NaGdF4:Yb(3+)/Tm(3+)@Tb(3+)/Eu(3+)) exhibit higher sensitivity in a wide range from 125 to 300 K based on two emissions of Tb(3+) at 545 nm and Eu(3+) at 615 nm under near-infrared laser excitation.
RESUMO
The effect of heat-treatment on the near-infrared (NIR) luminescence properties was studied in Bi-doped borate glasses. The luminescence intensity generally decreases with the increase of temperature, and the thermal stability can be improved by nearly 4.5 times with addition of 5 mol% La2O3. Collaborative studies by using steady photoluminescence (PL) and photoluminescence excitation (PLE) spectra, luminescence decay curve, differential thermal analysis (DTA), Raman spectra and X-ray diffraction (XRD) indicate that the luminescence decrement is associated with the agglomeration of Bi active centers during heat-treatment. The improvement of the thermal stability of NIR luminescence with the addition of La2O3 is benefited from the enhancement of structure rigidity due to the strong cationic field strength of La3+. The results not only provide valuable guidance for suppressing performance degradation of Bi-doped glass during fiber drawing process, but also present an effective way to control the luminescence properties of main group elements in glasses from the perspective of glass structure.