Onion (Allium cepa L.) as a new host for 'Candidatus Arsenophonus phytopathogenicus' in Germany.

Onion (Allium cepa L.) is the most produced vegetable after tomato worldwide and is grown on about 15,000 ha in Germany. In Lampertheim, Hesse in southwest Germany (49°40'02.3"N, 8°26'00.0"E) bulbs of the cultivar 'Red Baron F1' were harvested in September 2023 in an apparently healthy state. Four months later some of the onions showed rotting symptoms, which could not be assigned to a known storage disease. At first, the bulbs became glassy, later they showed soft rot. They originated from a field located in a growing region severely affected by "Syndrome Basses Richesses" (SBR). 'Candidatus Arsenophonus phytopathogenicus' as well as 'Candidatus Phytoplasma solani' are associated with this disease in sugar beet (Gatineau et al. 2002). Moreover, 'Ca. A. phytopathogenicus' was recently reported in association of bacterial wilt and yellowing in potato (Behrmann et al. 2023). Both phloem-restricted bacteria are vectored by the polyphagous planthopper Pentastiridius leporinus (Therhaag et al. 2024), which is highly abundant in this region. To examine, if the unknown symptoms in onion might be related to the presence of these pathogens, DNA of 69 bulbs showing a different degree of softening were analyzed. The samples were tested for the presence of 'Ca. Phytoplasma solani' in a TaqMan assay (Behrmann et al. 2022). All showed negative results. To demonstrate the presence of 'Ca. A. phytopathogenicus', universal and genus-specific primers for the amplification of 16S rDNA and a real-time qPCR assay amplifying an hsp20 fragment were employed (Christensen et al. 2004, Zübert and Kube 2021). Two bulbs of the five positive samples were in an apparently healthy state, the other three showed light to moderate softening symptoms. The 16S rDNA fragments from two samples were sequenced on both strands and aligned. Both fragments were homologous. One fragment of 1474 bp fragment showing 100% homology to the 16S rDNA from SBR (accession no. AY057392) was submitted to GenBank (accession no. PP400342). Other taxa of 'Ca. Arsenophonus' showed 16S rDNA homologies of less than 99.3 %. To corroborate the finding onion samples were subjected to PCR reactions employing genus-specific primers for the conserved tufB, secY and manA gene, which had been derived from multiple alignments of 'Ca. A. spp' sequence submissions (Sela et al. 1989, Lee et al. 2010). The tufB, secY and manA primers amplified fragments of about 980 bp, 640 bp and 930 bp, respectively, from all previously positive samples. Samples which had been tested negative for 'Ca. P. phytopathogenicus' remained negative. Fragments from two accessions were sequenced and the sequences from both isolates were 100 % identical. A BLAST search of the partial tufB gene (acc. no. PP950434) showed 98.57 % sequence identity to a yet unnamed Arsenophonus endosymbiont (acc. no. OZ026540) and 91.85 to 91.83 % to 'Ca. A. nasoniae' and 'Ca. A. apicola', respectively. A similar result was obtained for the partial secY sequence (acc. no. PP950433). The manA sequence (acc. no. PP942231) was identical to a partial sequence of 'Ca. A. phytopathogenicus' strain HN (acc. no. OK335757) and 97.42 % to 'Ca. A. nasoniae and about 87 % to related Arsenophonus species. The finding of 'Ca. A. phytopathogenicus' in onion is novel and might indicate an expanding host range of vector and pathogen in the regional crop rotation. As a correlation between the pathogen and the soft rot symptom is unclear at present, further investigations are needed.

Powdery Mildew of Xanthium strumarium Caused by Podosphaera xanthii in central China.

Xanthium strumarium, known as cocklebur, is an annual herb and has been used in traditional Chinese medicine. In October 2020, powdery mildew-like disease signs and symptoms were observed on X. strumarium grown in a crop field, Xinxiang city, Henan Province, China (35.36076° N, 113.93467° E). The specimen (PX-XS2023) was stored in Xinxiang Key Laboratory of Plant Stress Biology. White colonies in irregular or coalesced circular shaped-lesions were abundant on both ad- and abaxial surfaces of leaves and covered up to 99 % of the leaf area. Some of the infected leaves were senesced. More than 70 % of plants (n = 130) exhibited these signs and symptoms. Conidiophores were straight or slightly curved, 55 to 160 × 11 to 13 µm composed of foot-cells, shorter cells and conidia. Conidia were ellipsoid to oval, 29 to 40 × 14 to 20 µm (n = 50), with a length/width ration of 2.0 to 2.5, containing fibrosin bodies. Dark brown to black chasmothecia were found on infected leaves. The appendages were mycelium-shaped and at the base of scattered or gregarious chasmothecia (n = 50, 70 to 120 µm in diameter). Asci were 55 to 80 × 50 to 65 µm (n=30). These morphological characteristics were consistent with those of Podosphaera xanthii (Braun and Cook 2012). The internal transcribed spacer (ITS) region and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) region of the fungus (PX-XS2023) were amplified and sequenced with primers ITS1/ITS4 (White et al. 1990) and GAPDH1/GAPDH3R (Bradshaw et al. 2022) according to a previously reported method (Zhu et al. 2022). The resulting sequences were respectively deposited into GenBank (Accession No. MW300956 and PP236083). BLASTn analysis indicated that the sequences were respectively 99.82 % (564/565) and 100% (272/272) identical to P. xanthii (MT260063 and ON075658). The phylogenetic analysis indicated that the strain PX-XS2023 and P. xanthii were clustered into a same branch. Therefore, the causal agent of powdery mildew on X. strumarium was P. xanthii. To conduct pathogenicity assays, mature leaves of five healthy X. strumarium (height in 50 centimeters) were inoculated with fungal conidia by gently pressing surfaces of infested leaves onto leaves of healthy plants (Zhu et al. 2020). Five untreated plants served as controls. The controls and inoculated plants were separately maintained in greenhouses (humidity, 60%; light/dark, 16 h/8 h; temperature, 18°C). Eight days post-inoculation, signs of powdery mildew were detectable on inoculated plants, however, the controls were asymptomatic. Thus, the fungal pathogen was morphologically and molecularly identified and confirmed as P. xanthii. This powdery mildew caused by P. xanthii was previously reported on X. strumarium in Korea, Russia and India (Farr and Rossman, 2021). In addition, P. xanthii was recorded on X. strumarium in Xinjiang Province, China (Tai 1979). However, this is the first report of P. xanthii on X. strumarium in central China, where is around 3000 km away from Xinjiang Province with geographically differences. The sudden presence of powdery mildew caused by P. xanthii may adversely affect plant health and thus reduce medical value of X. strumarium. Therefore, the identification and confirmation of P. xanthii infecting X. strumarium enhance the knowledge on the hosts of this pathogen in China and will provide fundamental information for disease control in the future.

Droplet digital molecular beacon-LAMP assay via pico-injection for ultrasensitive detection of pathogens.

A pico-injection-aided digital droplet detection platform is presented that integrates loop-mediated isothermal amplification (LAMP) with molecular beacons (MBs) for the ultrasensitive and quantitative identification of pathogens, leveraging the sequence-specific detection capabilities of MBs. The microfluidic device contained three distinct functional units including droplet generation, pico-injection, and droplet counting. Utilizing a pico-injector, MBs are introduced into each droplet to specifically identify LAMP amplification products, thereby overcoming issues related to temperature incompatibility. Our methodology has been validated through the quantitative detection of Escherichia coli, achieving a detection limit as low as 9 copies/µL in a model plasmid containing the malB gene and 3 CFU/µL in a spiked milk sample. The total analysis time was less than 1.5 h. The sensitivity and robustness of this platform further demonstrated the potential for rapid pathogen detection and diagnosis, particularly when integrated with cutting-edge microfluidic technologies.

First Report of Fruit Rot Disease on melon (Cucumis melo L.) Caused by Fusarium ipomoeae in China.

Fusarium rot on melon fruit has become an important postharvest disease for producers worldwide, typically involving multiple Fusarium pathogens (Khuna et al. 2022; Medeiros Araújo et al. 2021). In 2022, Fusarium fruit rot of muskmelon (Cucumis melo var. conomon) occurred sporadically in a field at Huainan Academy of Agricultural Sciences (32.658193º N, 117.064922º E) with an incidence of about 10%. Among these diseased muskmelons, a fruit exhibiting a white to yellowish colony athe intersection of the diseased and healthy tissues was collected and labeled TGGF22-17. The streak plate method was employed to isolate fungal spores on Bengal Red PDA (potato dextrose agar), which were then incubated at 25℃ in darkness. Following isolation and purification, a single-spore strain, TGGF22-17, was obtained and analyzed using morphological characters on PDA, synthetic nutrient agar (SNA) and carnation leaf agar (CLA) (Leslie and Summerell 2006), along with molecular identification. Colours were rated according to the color charts of Kornerup and Wanscher (1978). Based on the colony morphology on PDA, the isolate displayed a rosy buff or buff color with a white to buff margin. The colony margin was undulate, with the reverse transitioning from amber-yellow to honey-yellow. Aerial macroconidia on SNA were thin-walled, hyaline, mostly 3-5 septate, falcate, and measured 18.5-46.4 (x̄=34.2) × 2.9-4.8 (x̄ =3.9) µm in size (n =50). Sporodochial macroconidia on CLA were mostly five-septate with long apical and basal cells, exhibiting dorsiventral curvature. They were hyaline, with the apical cell hooked to tapering and the basal cell foot-shaped, measuring 46.5-89.6 (x̄ =72.3) × 3.5-5.0 (x̄ =4.3) µm in size (n = 100). Portions of three loci (TEF-1α, RPB1 and RPB2) were amplified and sequenced as described by Wang et al. (2019). Sequences were deposited in GenBank with accession number PP196583 to PP196585. The three gene sequences (TEF-1α, RPB1 and RPB2) of strain TGGF2022-17 shared 99.5% (629/632bp), 97.9% (1508/1540 bp) and 99.9% (1608/1609 bp) identity to the ex-type strain F. ipomoeae LC12165 respectively by pairwise DNA alignments on the FUSARIOID-ID database (https://www.fusarium.org). Phylogenetic analysis of the partial TEF-1α and RPB2 sequences with PhyloSuite (Zhang et al. 2020) showed the isolated fungus clustered with F. ipomoeae. Based on the morphological and phylogenetic analyses, TGGF22-17 was identified as F. ipomoeae. Pathogenicity tests were performed on healthy melons, which were surface-sterilized with 75% alcohol and wounded using a sterilized inoculation needle. A 4-mm diameter plug from a 7-day-old SNA culture of TGGF22-17 was aseptically inserted in the middle of the wound, sealed with plastic bag after absorbent cotton was included to maintain moisture. Five melons were each inoculated at three points. Noncolonized PDA agar plugs served as the negative control. The inoculated and uninoculated plugs were removed approximately 48 hours after inoculation. The melon inoculated with TGGF22-17 exhibited water-soaked black lesions 48h post-inoculation, resulting in a 100% infection rate (15/15). After 7 days, mycelium was obseved on the inoculated melons. No disease symptoms were observed on the uninoculated melons. To fulfill Koch's postulates, fungi were isolated from the inoculated fruit and confirmed as F. ipomoeae by morphological observation. Fusarium ipomoeae has been reported to cause fruit rot on winter squash (Cucurbita maxima) in Japan (Kitabayashi et al. 2023). To our knowledge, this is the first report of fruit rot on muskmelon caused by F. ipomoeae in China and this report will be valuable for monitoring and management of fruit rot disease on muskmelons.

Clinical diagnostic value of targeted next­generation sequencing for infectious diseases (Review).

As sequencing technology transitions from research to clinical settings, due to technological maturity and cost reductions, metagenomic next­generation sequencing (mNGS) is increasingly used. This shift underscores the growing need for more cost­effective and universally accessible sequencing assays to improve patient care and public health. Therefore, targeted NGS (tNGS) is gaining prominence. tNGS involves enrichment of target pathogens in patient samples based on multiplex PCR amplification or probe capture with excellent sensitivity. It is increasingly used in clinical diagnostics due to its practicality and efficiency. The present review compares the principles of different enrichment methods. The high positivity rate of tNGS in the detection of pathogens was found in respiratory samples with specific instances. tNGS maintains high sensitivity (70.8­95.0%) in samples with low pathogen loads, including blood and cerebrospinal fluid. Furthermore, tNGS is effective in detecting drug­resistant strains of Mycobacterium tuberculosis, allowing identification of resistance genes and guiding clinical treatment decisions, which is difficult to achieve with mNGS. In the present review, the application of tNGS in clinical settings and its current limitations are assessed. The continued development of tNGS has the potential to refine diagnostic accuracy and treatment efficacy and improving infectious disease management. However, further research to overcome technical challenges such as workflow time and cost is required.

Development of a TaqMan assay for the detection of 'Candidatus Phytoplasma brasiliense' and assessment by high resolution melt-curve analysis (HRMA).

'Candidatus Phytoplasma brasiliense' (CPB) is a phytoplasma originally discovered in South America and is known to infect a wide variety of economically important crops. It is most prevalent in Hibiscus spp. where it causes witches broom symptoms and papaya where it causes bunchy top. Recently, CPB was documented for the first time in North America in a new host, globe sedge. In this study two qPCR assays are developed, one utilizing high resolution melt curve analysis (HRMA) based on the secA gene and the other a TaqMan assay based on the dnaK gene. The secA/HRMA and dnaK/TaqMana ssay successfully amplified isolates of CPB. Both assays were screened against available isolates of 16SrI, 16SrII and 16SrIV phytoplasmas. The secA/HRMA assay failed to amplify 16SrI, 16SrIII and 16SrIV phytoplasmas but successfully amplified 16SrII phytoplasmas. The resulting Tm products of CPB and 16SrII phytoplasmas displayed a difference of 0.5°C difference, easily distinguishing them by melt curves. The dnaK/TaqMan assay failed to amplify all non-CPB phytoplasma isolates in the study. The development of these assays provides a valuable tool that will significantly improve monitoring programs in Florida and will aid in developing a better fundamental understanding of the epidemiology of this phytoplasma.

First Report of Leaf Spot Disease on Lonicera japonica Caused by Nigrospora oryzae in China.

Lonicera japonica Thunb. is a traditional Chinese medicinal plant, which widely cultivated in China, Japan and Korea. From August to October in 2021 and 2022, severe leaf spots symptoms were observed on L. japonica in medicinal botanical garden of Shandong University of Traditional Chinese Medicine (36°55'89"N, 116°79'91"E), Jinan, Shandong Province, China. The disease incidence was above 80% in the 25 acre cultivation area. Early symptoms were small brown spots on the leaves. Then the number of small spots gradually increased and spread over the entire leaves. The small brown spots seldom merge together to form larger lesions. Leaves with typical symptoms were collected from twenty individual plants, and cut into small 5×5 mm fragments in the junction of infected and healthy tissues. The fragments were sterilized in 75% ethanol for 30 s and 1% NaClO for 60 s, rinsed three times in sterile water, and then placed on potato dextrose agar (PDA). After 3 days of incubation at 25°C, fungal plugs along the edge of the colony were cut and transferred to new PDA for purification. A total number of 23 colonies with similar morphological characteristics were obtained, and three representative strains (Lj14, Lj18 and Lj20) were selected for subsequent study. The colonies grew rapidly on PDA and covered the entire petri dish in 4 days. Colonies had abundant aerial hyphae, initially white, round, later turning gray and black. Conidia were oblate or nearly spherical, single-celled, black, and measured in size from 9.6 to 13.2 µm × 7.9 to 16.1 µm in diameter (n=150) (Figure S1). The observed characteristics were close to those of Nigrospora spp. ( Wang et al. 2017). The genomic DNA was extracted, and PCR amplification of the rDNA internal transcribed spacer (ITS), ß-tubulin gene (TUB), and translation elongation factor 1-alpha gene (TEF1) were completed by primers ITS1/ITS4, Bt2a/Bt2b and EF1-728F/EF1-986R (Carbone and Kohn, 1999). Sequences were deposited in GenBank (accession nos. OR936661, OR936662, OR936671 for ITS, OR947626, OR947627, OR947628 for TUB, and OR947629, OR947630, OR947631 for TEF1 sequences, respectively). BLAST analyses of ITS (OR936661), TUB(OR947626) and TEF1 (OR947629) sequences exhibited 100% (487 bp out of 487 bp), 99.48% (380 bp out of 382 bp), and 99.6% (248 bp out of 249 bp) similarity to the sequences of N. oryzae strains KoLRI_053384 (MZ855426), LC2991 (KY019496) and LC7307 (KY019409), respectively. Lj14, Lj18 and Lj20 formed a clade with N. oryzae LC6763 and LC2991 in phylogenetic tree (Figure S2). Based on morphological and molecular evidence, the pathogen was identified as N. oryzae (Berk. &Broome) Petch. To fulfill Koch's postulates, the pathogenicity was tested in vivo experiments. Thirty non-wounded healthy leaves of ten intact plants were inoculated with 10 µl spore suspension (106 spores/ml) of three strains, respectively. As negative control, thirty leaves of ten healthy plants were inoculated with sterile water. The inoculated plants were placed at 28°C in the growth chamber with high relative humidity. The pathogenicity tests were repeated three times. Distinct symptoms similar to that of natural conditions were observed on the leaves of inoculated plants after 4 to 7 days. The strain was reisolated from the lesions and identified as N. oryzae by morphological features and ITS sequence. The pathogen has been reported to cause leaf spot disease on tobacco (Wang et al. 2022) and asiatic dayflower (Qiu et al. 2022). To our knowledge, this is the first report of leaf spot caused by N. oryzae on Lonicera japonica in China. The research will be helpful for leaf spot disease control.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

First report of Fusarium verticillioides causing leaf rot on Artemisia argyi in China.

Artemisia argyi is a perennial herb native to East Asia. It is an important traditional Chinese medicinal plant known for its strong flavor and medicinal effects. It is rich in active ingredients and has a wide range of biological activities, including anti-inflammatory, antioxidant, and immune regulation properties. From May to July in 2023, a serious leaf rot outbreak occurred on A. argyi in several farms (approximately 200 acres) in Tanghe county (32°46'44" N, 112°43'13" E), Henan Province, China. The incidence rate reached 65% (n=200). Pale yellow spots (1-2 cm in diameter) first appeared on the leaves, then expanded to form irregular yellowish-brown lesions, eventually causing the entire leaves to wither. Diseased leaves (30) were collected and cut into 5 x 5 mm2 pieces in the areas between infected and healthy tissues. The excised plant tissues were sterilized in 75% ethanol and 1% sodium hypochlorite solution for 30 seconds and one minute, respectively. The tissues were then rinsed with sterile water and placed on potato dextrose agar (PDA) followed by incubating at 25 °C for 3 days. The isolated strains belonged to the genera Fusarium and Alternaria. After pathogenicity verification, 25 purified Fusarium strains were obtained. Three representative strains (AC-Q, AC-X, AC-Y) from different regions were used for further studies. Each strain formed abundant aerial mycelium that was initially white and later developed into purple pigments. Aerial conidiophores were sparsely branched, terminating with verticillate phialides. Macroconidia were slender, straight, and measured 21.8 to 47.5 × 3.1 to 4.4 µm, with two to four septa. Microconidia were clavate and measured 8.31 to 11.6 × 2.1 to 3.5 µm. Morphological characteristics were consistent with the species description of Fusarium verticillioides (Sacc.) Nirenberg 1976 (Leslie and Summerell, 2006). The rDNA internal transcribed spacer (ITS), ß-tubulin gene (tub2), translation elongation factor 1-alpha gene (tef1), calmodulin (cmdA), RNA polymerase II largest subunit (rpb1) and RNA polymerase II second largest subunit (rpb2) were amplified for molecular identification (O'Donnell et al., 2022). The sequences were deposited in GenBank with accession Nos. OR960548, OR960552, OR960555 (ITS), OR972413, OR972414, OR972415 (tub2), OR797685, OR797686, OR797687 (tef1), OR972410, OR972411, OR972412 (cmdA), PP035106, PP035107, PP035108 (rpb1), and PP035109, PP035110, PP035111 (rpb2). BLASTn analysis of AC-Q sequences exhibited 99 to 100% similarity with F. verticillioides sequences (strains CBS 576.78) MT010888 of cmdA, MT0109566 of rpb1, and MT010972 of rpb2. A phylogenetic tree was constructed with concatenated sequences (tub2, tef1, cmdA, rpb1, rpb2), alongside the sequences of the type strains using the neighbor-joining method. The three strains formed a clade with the type strain CBS 576.78 of F. verticillioides, and were separated from other Fusarium spp. These morphological and molecular identifications indicated that the pathogen was F. verticillioides. Pathogenicity was tested on 10 healthy 2-month-old potted seedlings by spraying them with a conidial suspension (106 conidia ml-1), and 5 seedlings were sprayed with sterilized water as a control. The plants were placed in a climate incubator at 28°C and a relative humidity of approximately 90%. Ten days after seedling inoculation, typical lesions were observed on the treated plants, except in the control group. The reisolated strains were identified as F. verticillioides by morphological and molecular characterization, fulfilling Koch's postulates. F. verticillioides is known to cause Fusarium ear rot on maize, as well as diseases on other plants in China such as Brassica rapa (Akram et al., 2020) and Schizonepeta tenuifolia (Li et al., 2024). This is the first report of F. verticillioides causing leaf rot on A. argyi worldwide. Identification of the pathogen is crucial for implementing management approaches to reduce yield losses.

A Comprehensive Methodology for Microbial Strain Typing Using Fourier-Transform Infrared Spectroscopy.

Timely and accurate detection and characterization of microbial threats is crucial for effective infection and outbreak management. Additionally, in food production, rapid microbe identification is indispensable for maintaining quality control and hygiene standards. Current methods for typing microbial strains often rely on labor-intensive, time-consuming, and expensive DNA- and sera-serotyping techniques, limiting their applicability in rapid-response scenarios. In this context, the IR Biotyper®, utilizing Fourier-transform infrared (FTIR) spectroscopy, offers a novel approach, providing specific spectra for fast strain typing within 3 h. This methodology article serves as a comprehensive resource for researchers and technicians aiming to utilize FTIR spectroscopy for microbial strain typing. It encompasses detailed guidelines on sample preparation, data acquisition, and analysis techniques, ensuring the generation of reliable and reproducible results. We highlight the IR Biotyper®'s rapid and accurate discrimination capabilities, showcasing its potential for real-time pathogen monitoring and source-tracking to enhance public health and food safety. We propose its integration as an early screening method, followed by more detailed analysis with whole-genome sequencing, to optimize detection accuracy and response efficiency in microbial surveillance systems.

Rapid detection of viral, bacterial, fungal, and oomycete pathogens on tomato with microneedles, LAMP on a microfluidic chip, and smartphone device.

Rapid detection of plant diseases before they escalate can improve disease control. Our team has developed rapid nucleic acid extraction methods with microneedles (MN) and combined these with LAMP assays for pathogen detection in the field. In this work, we developed LAMP assays for early blight (Alternaria linariae, A. alternata, and A. solani) and bacterial spot of tomato (Xanthomonas perforans) and validated these LAMP assays and two previously developed LAMP assays for tomato spotted wilt virus and late blight. Tomato plants were inoculated and disease severity was measured. Extractions were performed using MN and LAMP assays were run in tubes (with hydroxynaphthol blue) on a heat block or on a newly designed microfluidic slide chip on a heat block or a slide heater. Fluorescence on the microfluidic chip slides was visualized using EvaGreen and photographed on a smartphone. Plants inoculated with X. perforans or tomato spotted wilt virus tested positive prior to visible disease symptoms, while P. infestans and A. linariae were detected at the time of visual disease symptoms. LAMP assays were more sensitive than PCR and the limit of detection was 1 pg of DNA for both A. linariae and X. perforans. The LAMP assay designed for early blight detected all three species of Alternaria that infect tomato and is thus an Alternaria spp. assay. This study demonstrates the utility of rapid MN extraction followed by LAMP on a microfluidic chip for rapid diagnosis of four important tomato pathogens.

Deep Learning Based Barley Disease Quantification for Sustainable Crop Production.

Net blotch disease caused by Drechslera teres is a major fungal disease that affects barley (Hordeum vulgare) plants and can result in significant crop losses. In this study, we developed a deep-learning model to quantify net blotch disease symptoms on different days post-infection on seedling leaves using Cascade R-CNN (Region-Based Convolutional Neural Networks) and U-Net (a convolutional neural network) architectures. We used a dataset of barley leaf images with annotations of net blotch disease to train and evaluate the model. The model achieved an accuracy of 95% for cascade R-CNN in net blotch disease detection and a Jaccard index score of 0.99, indicating high accuracy in disease quantification and location. The combination of Cascade R-CNN and U-Net architectures improved the detection of small and irregularly shaped lesions in the images at 4-days post infection, leading to better disease quantification. To validate the model developed, we compared the results obtained by automated measurement with a classical method (necrosis diameter measurement) and a pathogen detection by real-time PCR. The proposed deep learning model could be used in automated systems for disease quantification and to screen the efficacy of potential biocontrol agents to protect against disease.

YDV Resistance in Barley: Phenotyping, Remote Imagery, and Virus-Vector Characterization.

Yellow Dwarf Viruses (YDV) spread by aphids are some of the most economically important barley (Hordeum vulgare L.) virus-vector complexes worldwide. Detection and control of these viruses are critical components in the production of barley, wheat, and numerous other grasses of agricultural importance. Genetic control of plant diseases is often preferable to chemical control to reduce the epidemiological, environmental, and economic cost of foliar insecticides. Accordingly, the objectives of this work were to I) screen a barley population for resistance to YDV under natural infection using phenotypic assessment of disease symptoms, II) implement drone imagery to further assess resistance and test its utility as a disease screening tool, III) identify the prevailing virus and vector types in the experimental environment, and IV) perform a genome-wide association study to identify genomic regions associated with measured traits. Significant genetic differences were found in a population of 192 barley inbred lines regarding their YDV symptom severity and symptoms were moderately to highly correlated with grain yield. The severity of YDV measured with aerial imaging was highly correlated with on-the-ground estimates (r=0.65). Three aphid species vectoring three YDV species were identified with no apparent genotypic influence on their distribution. A QTL impacting YDV resistance was detected on chromosome 2H, albeit undetected using aerial imaging. However, QTL for canopy cover and mean NDVI were successfully mapped using the drone. This work provides a framework for utilizing drone imagery in future resistance breeding efforts for YDV in cereals and grasses, and in other virus-vector disease complexes.

Colletotrichum caladii sp. nov. causing anthracnose leaf spot of Caladium × hortulanum (Araceae) in Florida, USA.

Caladium (Caladium × hortulanum) is an ornamental plant popular for its variable and colorful foliage. In 2020, plants showing leaf spots and blight, typical of anthracnose, were found in a field trial at the University of Florida's Gulf Coast Research and Education Center (UF/GCREC) in Wimauma, FL, USA. Leaf samples consistently yielded a Colletotrichum-like species with curved conidia and abundant setae production in the acervuli. The internal transcribed spacer (ITS), partial sequences of the glyceraldehyde-3-phosphate dehydrogenase gene (gapdh), actin gene (act), chitin synthase 1 gene (chs-1), beta-tubulin gene (tub2), and histone3 gene (his3) were amplified and sequenced. Blastn searches in the NCBI GenBank database revealed similarities to species of the Colletotrichum truncatum species complex. Phylogenetic analyses using multi-locus sequence data supports a distinct species within this complex, with the closest related species being C. curcumae. Based on morphological and phylogenetic analyses, a new species of Colletotrichum, named C. caladii, is reported. Pathogenicity assays and subsequent isolation confirmed that this species was the causal agent of the disease.

First Report of Root Rot of Cathaya argyrophylla caused by Fusarium oxysporum in China.

Cathaya argyrophylla [Chun & Kuang.] is an ancient relict plant and its embryonic development is similar to that of Pinus species. This has important scientific value for studying the phylogeny of Pinaceae (Wu et al. 2023). In July 2022, root rot was detected in the seedling cultivation base of C. argyrophylla in Daozhen County, Guizhou Province, China (28.89 °N, 107.6 °E). The incidence of the disease was 30% (n = 100); the susceptible plants wilted, leaves withered, and roots showed brown-to-black lesions and rot. Ten root tissues were randomly collected from the edges of the lesions of six symptomatic susceptible plants. The tissues were sterilized with 75% alcohol for 30 seconds, followed by 2-minute immersion in 3% sodium hypochlorite. After washing with sterile water, the tissues were incubated on potato dextrose agar (PDA; BoWei, Shanghai) at 28 ℃ for five days. Four single-spore cultures were obtained using a single-spore isolation method (Gong et al., 2010). Single-spore cultures grew rapidly on PDA. After five days of incubation, the colonies were white and pink, indicating a large amount of aerial mycelia. Microconidia were ovate or ellipsoid, measuring 5.0-10.0 × 1.5-3.0 µm (n = 50); Macroconidia were falcate, slightly curved or straight, measuring 19.5-28.5 × 2.0-6.0 µm (n = 50). Based on morphological features, the pathogen was considered to be Fusarium spp. (Leslie and Summerell 2006). Three representative strains, GF5, GF6, and GF7, were selected for molecular identification, and genomic DNA was extracted to confirm morphological diagnosis. The internal transcribed spacer (ITS) (White et al. 1990) was amplified using primers ITS1/ITS4, and the ß-tubulin gene (Varga et al. 2011) was amplified using primers Bt2a/Bt2b. The ITS and ß-tubulin sequences were aligned with GenBank, and amplification of the genes from the three isolates was consistent. The ITS (OP482273) and ß-tubulin (OR825353) sequences of GF5 were stored in GenBank, and their homology with Fusarium oxysporum HC131(accession numbers MW600442 and MW670451) was 99 to 100%. Maximum likelihood analysis using MEGA 11.0 showed that isolate GF5 belongs to F. oxysporum. The reconstructed phylogenetic tree confirmed the phylogenetic position of the isolate GF5. The pathogenicity test was carried out using GF5 and GF6 isolates. The taproots of ten 3-year-old C. argyrophylla plants were washed, and then the roots were immersed in a 2 × 106/mL conidial suspension for one hour. Ten plants with sterile water were used as controls. After planting in pots (30 × 25 cm) with sterilized forest soil, the plants were cultured in a greenhouse (25 ℃ and 12-hour photoperiod). Thirty days after inoculation, all plants inoculated with the isolated pathogen showed wilting symptoms, and the roots showed typical root rot symptoms, whereas the control group showed no symptoms. The pathogens re-isolated from all inoculated plants were morphologically identical and had ITS sequences identical to F. oxysporum, validating Koch's hypothesis. The pathogenicity test was repeated twice and similar results were obtained. Although this fungus has been previously reported to cause root diseases in hosts, such as Musa nana Lour. and Pinus massoniana Lamb. (He et al. 2010; Luo et al. 2020), to our knowledge, this is the first report of F. oxysporum causing root rot in C. argyrophylla. These findings provide a basis for the development of management strategies for C. argyrophylla infection.

Pathological characterization and management of Lasiodiplodia theobromae, a hemi-biotroph with an interkingdom host range.

Heart rot disease, caused by Lasiodiplodia theobromae, is destructive for date palms and other woody plants. The disease was reported in several oasis in Egypt, and the pathogen was found in association with infected trees suffering die-back and rachis blight. Seven phylogenetically distinct fungal isolates were selected, and their pathogenicity was confirmed on date palms. The isolates exhibited variable degrees of virulence on inoculated leaves, which confirms the variation. We examined the antifungal effect of microbial bioagents and plant extracts on heart rot disease. The isolates of Trichoderma spp. gave moderate reduction of the pathogen's linear growth (40-60%), while their exudates were ultimately ineffective. Bacillus spp. isolates, except for B. megaterium, were more effective against spore germination as they gave 80-90% reduction on average. Among the examined plant extracts garlic sap gave 98.67% reduction of linear growth followed by artemisia (15.5%) and camphor (24.8%). The extraction methods greatly influenced the antifungal efficiency of each extract as exposure to organic solvents significantly decreased the efficiency of all extracts, while hot water extraction negatively affected garlic sap only. Successful bioagents and plant extracts were further assayed for the suppression of heart rot disease on date palms. Both T. album and T. harzianum gave comparable degrees of suppression as by commercial fungicides. In addition, treatment before or during pathogen inoculation was the most effective as it significantly enhanced the expression of defense-related enzymes. Our findings suggest bio-pesticides possessing a dual role in disease suppression and defense boosters for date palms suffering heart rot disease.

Survey of Heterodera glycines population abundance and virulence phenotypes during 2021-2022 in Heilongjiang Province.

Soybean cyst nematode (SCN), Heterodera glycines, poses a significant threat to global soybean production. Heilongjiang, the largest soybean-producing province in China, contributes over 40% to the country's total yield. This province has much longer history of SCN infestation. To assess the current situation in Heilongjiang, we conducted a survey to determine the SCN population density and virulence phenotypes during 2021-2022 and compared the data with a previous study in 2015. A total of 377 soil samples from 48 counties representing eleven major soybean-planting regions were collected. The prevalence of SCN increased from 55.4% in 2015 to 59% in the current survey. The population densities ranged from 80 to 26,700 eggs and juveniles per 100 cm3 of soil. Virulence phenotypes were evaluated for 60 representative SCN populations using the HG type test, revealing nine different HG types. The most common virulence phenotypes were HG types 7 and 0, accounting for 56.7% and 20% of all SCN populations, respectively. The prevalence of populations with a reproductive index (FI) greater than 10% on PI548316 increased from 64.5% in 2015 to 71.7%. However, the FI on the commonly used resistance sources PI 548402 (Peking) and PI 437654 remained low at 3.3%. These findings highlight the increasing prevalence and changing virulence phenotypes of SCN in Heilongjiang. They also emphasize the importance of rotating soybean varieties with different resistance sources and urgently identifying new sources of resistance to combat SCN.

Phytophthora pseudocryptogea Is Associated with Root and Crown Rot of Nursery-Grown Common Sage in Hungary.

In October 2009, necrotic bark lesions at the root collar and lower stem associated with root rot, reduced growth, and wilting were observed on container-grown 2-year-old common sage (Salvia officinalis L. 'Icterina') in two ornamental nurseries in Somogy and Zala counties in Hungary. The disease occurred at a frequency of 15-20% (100 to 150 symptomatic plants in each nursery). A P. cryptogea-like species was isolated consistently from necrotic root collars of many plants on carrot (CA) PARPB agar. Six isolates from the nursery in Zala county and three isolates from the nursery in Somogy county were deposited in the culture collection of Plant Protection Institute (Budapest, Hungary). All developed slightly petaloid colonies on CA agar. Chlamydospores and gametangia were not present in single and dual culture combinations of isolates. Radial colony growth was the fastest at 25°C (6.8 to 7.4 mm/day) and no growth occurred above 34°C. On mycelial discs floating in nonsterile stream water, persistent, nonpapillate, mostly ovoid to obpyriform sporangia (37.4±3.5 to 47.8±4.6 µm long and 22.3±2.6 to 29.2±3.7 µm wide) and hyphal swellings were produced abundantly. Pathogenicity of one selected isolate from each nursery was tested on 3-month-old seedlings of S. officinalis 'Icterina' in 2010. Isolates were grown for 4 weeks at 20°C on autoclaved millet grains moistened with CA broth. Infested and uninfested grains were mixed with autoclaved soil (30 cm3 grain/liter), and the mixes were used as potting media for transplanting five treated and five control plants per isolate, respectively. Plants were kept in a growth room (20-25°C, 16/8 h dark/light). Pots were flooded for 24 hours on the 1st day and every 2 weeks. All and only treated plants showed symptoms of wilt associated with basal stem and root necrosis within three weeks. The trial was repeated with the same result. The pathogen could be reisolated only from the treated plants. Identity of isolates from nurseries and inoculated plants was confirmed recently by amplification and sequence analysis of the rDNA internal transcribed spacers (ITS) and gene regions of cytochrome c oxidase subunit I (coxI) and ß-tubulin (tub) according to Jung et al. (2017). BLASTn searches showed 100% identity and only 97.3-99.0% similarity to the corresponding sequences of authenthic P. pseudocryptogea and P. cryptogea strains, respectively (e.g., GenBank accession nos. KP288336-KP288342, KP288370-KP288372, KP288386-KP288392, MN872725, MN872776). Sequences of the 9 field isolates were deposited in GenBank under accession nos. OR771701-OR771709 (ITS), OR787508-OR787516 (coxI) and OR787517-OR787525 (tub). P. pseudocryptogea was delineated from P. cryptogea sensu lato (Safaiefarahani et al. 2015), which has been reported from S. officinalis in the United States (Koike 1997), and S. leucantha (Cacciola et al. 2002) and S. officinalis (Garibaldi et al. 2015) in Italy. The known natural hosts of P. pseudocryptogea includes plant species in families other than Lamiaceae (cf. Aloi et al. 2023), but it was pathogenic on the lamiaceous Plectranthus scutellarioides in artificial inoculations (Christova 2020). The pathogen is present in European nurseries (Antonelli et al. 2023). This is the first report of P. pseudocryptogea on S. officinalis in Hungary. The causal agent threatens the production of sages and other ornamentals, and its spread in Hungary should be prevented by proper disease management and phytosanitary actions.

First Report of White Mold Caused by Sclerotinia sclerotiorum on Hymenocallis glauca in Mexico.

In Mexico, there are 29 native species of the genus Hymenocallis, where H. glauca is one of the most cultivated bulbous plants. It holds economic importance as it is commercialized as a potted plant and cut flower (Leszczyñska and Borys, 2001). In October 2023, field sampling was conducted in the Research Center in Horticulture and Native Plants (18°55'55" N, 98°24'02.8"W) of UPAEP University. H. glauca diseased plants were found in an area of 0.4 ha, with an incidence of 35% and an estimated severity of 45% on infected plants in vegetative stage. The symptoms included chlorosis of foliage, necrosis at the base of the stem, and soft rot with abundant white to gray mycelium and abundant production of black, irregular sclerotia of approximately 3.5 mm diameter. Finally, the plants wilted and died. The fungus was isolated from 40 symptomatic plants. Sclerotia were collected, disinfested with 3% NaOCl for one minute, rinsed with sterile distilled water (SDW), and plated on Petri dishes containing potato dextrose agar (PDA) with sterile forceps. Subsequently, a sterile dissecting needle was used to place fragments of mycelium directly on Petri dishes with PDA. Plates were incubated at 23 °C in dark for 7 days. One isolate was obtained from each diseased plant by the hyphal-tip method (20 isolates from sclerotia and 20 from mycelium). After 7 days, colonies had fast-growing, dense, and cottony-white aerial mycelium forming irregular sclerotia of 3.57 ± 0.59 mm (mean ± standard deviation, n=100). In each Petri dish there were produced 21.5 ± 7.9 sclerotia (mean ± standard deviation, n=40), after 11 days; these were initially white and gradually turned black. The isolates were tentatively identified as Sclerotinia sclerotiorum based on morphological characteristics (Saharan and Mehta 2008). Two representative isolates were chosen for molecular identification and genomic DNA was extracted by the CTAB protocol. The ITS region and the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene were amplified and sequenced (Staats et al. 2005; White et al. 1990). The sequences of a representative isolate (SsHg3) were deposited in GenBank (ITS- PP094578; G3PDH- PP101843). BLAST analysis of the partial sequences ITS (519 bp), and G3PDH (950 bp) showed 100% similarity to S. sclerotiorum isolates (GenBank: MG249967, MW082601). Pathogenicity was confirmed by inoculating 30 H. glauca plants in vegetative stage grown in pots with sterile soil. Ten sclerotia were deposited at the base of the stem, 10 mm below the soil surface. As control treatment, SDW was applied to 10 plants. The plants were placed in a greenhouse at 23 °C and 90% relative humidity. After 17 days, all inoculated plants displayed symptoms similar to those observed in the field, while no symptoms were observed on the controls. The fungus was re-isolated from the inoculated plants as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. S. sclerotiorum has been reported causing white mold on other bulbous plants, like fennel (Foeniculum vulgare) in Korea (Choi et al. 2015). To our knowledge, this is the first report of S. sclerotiorum causing white mold on H. glauca in Mexico. Information about diseases affecting this plant is very limited, so this research is essential for developing integrated management strategies and preventing spread to other production areas.

MALDI-TOF nucleic acid mass spectrometry for simultaneously detection of fourteen porcine viruses and its application.

BACKGROUND: Mixed infections of multiple viruses significantly contribute to the prevalence of swine diseases, adversely affecting global livestock production and the economy. However, effectively monitoring multiple viruses and detecting mixed infection samples remains challenging. This study describes a method that combines single-base extension PCR with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to detect important porcine viruses. RESULTS: Our approach accurately and simultaneously identified 14 porcine viruses, including porcine circovirus types 1-3, porcine bocaviruses groups 1-3, African swine fever virus, pseudorabies virus, porcine parvovirus, torque teno sus virus, swine influenza virus, porcine reproductive and respiratory syndrome virus, classical swine fever virus, and foot-and-mouth disease virus. The low limit of detection for multiplex identification ranges from 13.54 to 1.59 copies/µL. Inter- and intra-assay stability was found to be ≥98.3 %. In a comprehensive analysis of 114 samples, the assay exhibited overall agreement with qPCR results of 97.9 %. CONCLUSIONS: The developed MALDI-TOF NAMS assay exhibits high sensitivity, specificity, and reliability in detecting and distinguishing a wide spectrum of porcine viruses in complex matrix samples. This underscores its potential as an efficient diagnostic tool for porcine-derived virus surveillance and swine disease control.