RESUMO
In order to transform rural development, the implementation of disaster resettlement projects should not only reduce environmental hazards, but also improve the sustainability of natural resources and household well-being. This article assesses sustainable household well-being (SHWB) and natural resource dependence using a quantitative survey of rural China. It identifies four classes of relationship between SHWB and natural resource dependence and explores the impact of disaster resettlement on these classes. The result shows that rural households that participate in disaster resettlement as well as in voluntary relocation, centralized relocation, and new-stage relocation are more likely to achieve "high well-being and low dependence." However, the overall SHWB level of the relocated households is lower than that of the non-relocated households, and disaster resettlement also has a significant positive impact on the "low well-being and low dependence" class. It is recommended that governments implement measures to address these issues. The findings in this article could shed light on the impact of resettlement programs on rural households elsewhere.
Assuntos
Características da Família , População Rural , China , Humanos , Desastres , Recursos Naturais , Conservação dos Recursos NaturaisRESUMO
A large number of economic forests, especially apple orchards (AOs) in the Loess Plateau region of China, have been planted to develop the local economy and increase the income of farmers. The two main constraints preventing AOs on the Loess Plateau from developing sustainably and producing a high and steady yield are soil moisture content (SMC) and soil organic carbon (SOC). Nevertheless, little is currently known about the contributions of roots to these changes in the soil profile and the temporal modes of the SMC-SOC coupled effects. In our research, we analyzed the dynamic changes in SMC and SOC in AOs of various years in northern Shaanxi Province, as well as the coupled relationship between the two, and attempted to describe the function of roots in these changes. Research have shown: (1) As the age of the AOs increased, the SMC continued to decline throughout the 0-500 cm profile, especially at depths of 100-500 cm. SMC depletion mainly occurred in AOs aged 20 years (30.02%/year) and 30 years (31.18%/year). (2) Compared with abandoned land (AL), all the AOs except for the 6-year-old AO showed a carbon sequestration effect, and the carbon sequestration effect increased with age. The carbon sequestration rate of the 12-year-old AO was the highest and then decreased with age. Both surface and deeper soils showed better carbon sequestration, with a large amount of SOC being sequestered in deeper soil layers (> 100 cm). (3) The coupled effects of SMC and SOC varied with age and depth. The SMC in the deeper layers was significantly negatively correlated with SOC. Root dry weight density (RDWD) was significantly negatively correlated with SMC and significantly positively correlated with SOC. Path analysis suggested that SMC directly affects SOC at different soil depths, and regulates SOC by affecting RDWD, but these effects are significantly different at different depths. Therefore, we propose that management of AO should focus on the moisture deficit and carbon sequestration capabilities of deeper soils to ensure the sustainability of water use in AOs and the stability of agricultural carbon sequestration on the Loess Plateau.
RESUMO
INTRODUCTION: Obesity not only affects human health but also is an important risk factor for a variety of chronic diseases. Therefore, it is particularly important to analyse the epidemic trend of obesity and actively carry out the prevention and control of obesity in the population. MATERIAL AND METHODS: A total of 4565 adults were selected by multi-stage stratified random sampling in Shenmu, Shaanxi Province, China. Univariate analysis was used to explore the epidemic characteristics of obesity in this region. Multivariate logistic regression was used to analyse the relationship between obesity and chronic diseases. Finally, the prediction efficiency of different obesity indexes was analysed by drawing receiver operator characteristic curves (ROC). All statistical analysis was completed by SPSS 26.0 software. RESULTS: The prevalence rates of overweight, obesity, and central obesity were 39.9%, 18.2%, and 48.0%, respectively. After adjusting for other confounding factors, multivariate logistic regression analysis showed that overweight and obesity were risk factors for hypertension, dyslipidaemia, and hyperuricaemia. Central obesity is a risk factor for dyslipidaemia and hyperuricaemia. High level of waist-to-height ratio (WHtR) was a risk factor for dyslipidaemia and hyperuricaemia (p < 0.05). Obesity-related indicators: body mass index (BMI), waist circumference (WC), and WHtR, are strongly correlated with the increased risk of chronic diseases in northern Shaanxi, China. The optimal BMI cut-off values for predicting hypertension, dyslipidaemia, and hyperuricaemia were 24.27, 24.04, and 25.54, respectively. The optimal WC cut-off values for predicting dyslipidaemia and hyperuricaemia were 84.5 and 90.5, and WHtR cut-off values were 0.52 and 0.54, respectively. CONCLUSION: The problem of overweight, obesity, and central obesity in adults is serious in northern Shaanxi, China. Obesity of all types will increase the risk of chronic diseases. Therefore, a variety of preventive and therapeutic measures should be adopted to curb obesity and reduce the incidence of related chronic diseases.
Assuntos
Dislipidemias , Hipertensão , Hiperuricemia , Adulto , Humanos , Obesidade Abdominal/epidemiologia , Obesidade Abdominal/complicações , Sobrepeso/complicações , Hiperuricemia/epidemiologia , Hiperuricemia/complicações , Prevalência , Obesidade/complicações , Dislipidemias/complicações , China/epidemiologiaRESUMO
Shaanxi Province is an important agricultural province in western China. Its profit-oriented management of crop residues remains a concern in the agriculture sector. Aiming to accelerate the valorization of agricultural straw and offer potential solutions for profit-oriented use of crop residues in Shaanxi, this study estimated the quantity of resources and collectable amount of crop straw by using the grain-to-straw ratio, analyzed the carbon emission reduction potential considering biochar energy and soil uses with the help of a life cycle assessment (LCA) model, and calculated the economic benefits of biochar production using waste and abandoned straw in Weinan (a city of Shaanxi). The theoretical resources and collectible amount of crop straw in Shaanxi showed an overall growth trend from 1949 to 2021, reaching 1.47 × 107 and 1.26 × 107 t in 2021 respectively. In 2021, straw from corn, wheat, and other grains accounted for 94.32% of the total straw. Among the 11 cities in Shaanxi, Weinan had the largest straw resources of 2.82 × 106 t, Yulin had the largest per capita straw resources of 0.72 t/person, and Yangling had the highest resource density of 7.60 t/hm2. The total carbon emission reduction was 3.11 × 104 t under scenario A with crop straw used for power generation. The emission reduction ranged from 1.25 × 107 to 1.27 × 107 CO2e t under scenario B with biochar production for energy and soil use. By using waste and abandoned straw in Weinan for biochar production, carbon emissions could be reduced by up to 2.07 × 105 t CO2e. In terms of the economic benefit from straw pyrolysis, the actual income was estimated to range from 0.67 × 108 to 1.33 × 108 ¥/a with different carbon prices. This study sheds light on the economic and environmental benefits of agricultural straw valorization through pyrolysis in Shaanxi, and provided an important basis for promoting the agricultural straw utilization in view of its potential for carbon emission reduction.
RESUMO
Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25â for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.
RESUMO
Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2â. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.
RESUMO
Exploring the role of landscape patterns in the trade-offs/synergies among ecosystem services (ESs) is helpful for understanding ES generation and transmission processes and is of great significance for multiple ES management. However, few studies have addressed the potential spatial-temporal heterogeneity in the influence of landscape patterns on trade-offs/synergies among ESs. This study assessed the landscape patterns and five typical ESs (water retention (WR), food supply (FS), habitat quality (HQ), soil retention (SR), and landscape aesthetics (LA)) on the Loess Plateau of northern Shaanxi and used the revised trade-off/synergy degree indicator to measure trade-offs/synergies among ESs. The multiscale geographically weighted regression (MGWR) model was constructed to determine the spatial-temporal heterogeneity in the influence of landscape patterns on the trade-offs/synergies. The results showed that (1) from 2000 to 2010, the increase in cultivated land and the decrease in forestland and grassland increased landscape diversity and decreased landscape heterogeneity and fragmentation. During 2010-2020, the change range decreased, the spatial distribution was homogeneous, and the landscape diversity and fragmentation in the northwestern area increased significantly. (2) The supply of the five ESs continued to increase from 2000 to 2020. During 2000-2010, FS-SR, FS-LA and SR-LA were dominated by synergies. From 2010 to 2020, the proportion of trade-off units in all relationships increased, and HQ-FS, HQ-SR and HQ-LA were dominated by trade-offs. (3) Landscape patterns had complex impacts on trade-offs/synergies, and the same landscape variable could have the opposite impact on specific trade-offs/synergies in different periods and areas. The results of this study will inform managers in developing regional sustainable ecosystem management strategies and advocating for more research to address ecological issues from a spatial-temporal perspective.
Assuntos
Conservação dos Recursos Naturais , Ecossistema , Conservação dos Recursos Naturais/métodos , Florestas , Solo , Regressão Espacial , ChinaRESUMO
Cephalotaxus diterpenoids are attractive natural products with intriguing molecular frameworks and promising biological features. As a structurally unusual member, (-)-cephalotanin B possesses an extraordinarily congested heptacyclic skeleton, three lactone units, and nine consecutive stereocenters. Herein, we report an enantioselective total synthesis of (-)-cephalotanin B based on a divergent asymmetric Michael addition reaction, a novel Pauson-Khand/deacyloxylation process discovered in the development of a second-generation stereoselective Pauson-Khand reaction protocol, and an epoxide-opening/elimination/dual-lactonization cascade to construct the challenging propeller-shaped A-B-C ring system as key transformations.
RESUMO
Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi and Escherichia coli are important diarrheal pathogens threatening the health of humans and various animals. Goats, especially pre-weaned goat kids, that carry these pathogens are important reservoirs related to human infection. In the present study, PCR-based sequencing techniques were applied to characterize Cryptosporidium spp., G. duodenalis, E. bieneusi and E. coli in 202 fecal samples of diarrheal kids for Guanzhong dairy goats from five locations in Shaanxi Province. The positive rates of Cryptosporidium spp., G. duodenalis, E. bieneusi and E. coli were 37.6% (76/202), 16.3% (33/202), 55.4% (112/202) and 78.7% (159/202) in these goat kids, respectively. Co-infection of two to four pathogens was found in 114 of 202 fecal samples. Significant differences (p < 0.001) in the positive rates of Cryptosporidium spp. and G. duodenalis were found among locations and age groups. Furthermore, two Cryptosporidium species (C. parvum and C. xiaoi), two G. duodenalis assemblages (E and A), nine E. bieneusi genotypes (CHG3, CHG1, BEB6, CHG5, CHG2, SX1, CHG28, COS-II and CD6) and two E. coli pathotypes (EPEC and EHEC) were identified. As for Cryptosporidium, two (IIdA19G1 and IIdA19G2) and two (XXIIIa and XXIIIg) subtypes were recognized in samples positive for C. parvum and C. xiaoi, respectively. A phylogenetic analysis based on the ITS locus of E. bieneusi indicated that all nine genotypes of E. bieneusi identified in this study belonged to the group 2. Four virulence factors (ehxA, eae, stx2 and stx1) of EPEC and EHEC were found in E. coli strains. Collectively, this study explored the colonization frequency of Cryptosporidium spp., G. duodenalis, E. bieneusi and E. coli in diarrheal kids of Guanzhong dairy goats in Shaanxi Province and expanded our understanding of the genetic composition and zoonotic potential of these pathogens in goats.
RESUMO
Landscape fragmentation affected the structure and function of the ecosystem, resulting in an impact on ecosystem service value (ESV). This paper analyzed the correlation between landscape fragmentation and ESV using land-use data from northern Shaanxi covering three periods from 2000 to 2020. The paper employed the granularity deduction method, spatial autocorrelation analysis, and value equivalent method to study the fragmentation characteristics of the regional landscape and the spatial-temporal evolution of ESV. The research findings indicated that the optimal granularity was 150 m, and the amplitude was 5 km × 5 km. The study found that the degree of landscape fragmentation was positively correlated with patch density (PD), division index (DIVISION), and Shannon's diversity index (SHDI), while negatively correlated with the largest patch index (LPI), patch cohesion index (COHESION), and effective mesh size (MESH). Moreover, the total ESV in the study area showed a decreasing trend, with grass, forest, and cultivated land being the three land-use types that contributed the most value. The analysis indicated that there was a negative correlation between the degree of landscape fragmentation and ESV. As the degree of landscape fragmentation increased, ESV decreased. The correlation between landscape fragmentation and ESV discussed in this paper provided valuable insights into the optimal utilization and sustainable development of regional land resources.
Assuntos
Conservação dos Recursos Naturais , Ecossistema , Florestas , China , Análise EspacialRESUMO
Two new species of Ochlodes Scudder, 1872, Ochlodespseudochraceus Zhu, Fan & Wang, sp. nov. and Ochlodescryptochraceus Zhu, Fan & Chiba, sp. nov., are found in China and described, and Ochlodesrikuchina (Butler, 1878) stat. rev. is restored. A lectotype is designated for Pamphilaochracea Bremer, 1861, and a neotype is designated for Pamphilarikuchina Butler, 1878. Overall, the two new species are similar to Ochlodesochraceus (Bremer, 1861). They, however, can be distinguished from the latter and other species in the genus: O.pseudochraceus has long radial spots in spaces R3-5, and the lateral process of the phallus gradually widens at the distal half in male genitalia; O.cryptochraceus has the lateral process of the phallus enlarged only at the distal tip. Based on the phylogenetic analyses of the mitochondrial COI gene, members of currently defined O.ochraceus are grouped into four clades. The genetic distances between O.pseudochraceus and O.ochraceus, O.cryptochraceus and O.ochraceus, O.rikuchina and O.ochraceus, and O.pseudochraceus and O.cryptochraceus are 3.2%, 2.1%, 1.9%, and 2.7%, respectively. Based on the molecular and morphological evidence, O.pseudochraceus, O.cryptochraceus, and O.rikuchina are treated to be distinct species. The adult habitus and male and female genitalia of the new species are illustrated as well as those of O.ochraceus and O.rikuchina.
RESUMO
A small skeletal fossil assemblage is described for the first time from the bioclastic limestone interbeds of the siltstone-dominated Guojiaba Formation, southern Shaanxi, China. The carbonate-hosted fossils include brachiopods (Eohadrotreta zhujiahensis, Eohadrotreta zhenbaensis, Spinobolus sp., Kuangshanotreta malungensis, Kyrshabaktella sp., Lingulellotreta yuanshanensis, Eoobolus incipiens, and Eoobolus sp.), sphenothallids (Sphenothallus sp.), archaeocyaths (Robustocyathus sp. and Yukonocyathus sp.), bradoriids (Kunmingella douvillei), chancelloriids sclerites (Onychia sp., Allonnia sp., Diminia sp., Archiasterella pentactina, and Chancelloria cf. eros), echinoderm plates, fragments of trilobites (Eoredlichia sp.), and hyolithelminths. The discovery of archaeocyaths in the Guojiaba Formation significantly extends their stratigraphic range in South China from the early Tsanglangpuian at least to the late Chiungchussuan. Thus, the Guojiaba Formation now represents the lowest known stratigraphic horizon where archaeocyath fossils have been found in the southern Shaanxi area. The overall assemblage is most comparable, in terms of composition, to Small skeletal fossil (SSF) assemblages from the early Cambrian Chengjiang fauna recovered from the Yu'anshan Formation in eastern Yunnan Province. The existing position that the Guojiaba Formation is correlated with Stage 3 in Cambrian Series 2 is strongly upheld based on the fossil assemblage recovered in this study.
RESUMO
Global warming attributed to the emission of greenhouse gases has caused unprecedented extreme weather events, such as excessive heatwave and rainfall, posing enormous threats to human life and sustainable development. China, as the toppest CO2 emitter in the world, has promised to achieve carbon emission peak by 2030. However, it is difficult to estimate county-level carbon emissions in China because of the lack of statistical data. Previous studies have established relationship between carbon emission and nighttime light; however, using only nighttime light for carbon emission modeling ignores the impact of natural or other socioeconomic factors on emissions. In this paper, we adopted the back propagation neural network to estimate carbon emissions at county level in Shaanxi, China, using nighttime light, Normalized Difference Vegetation Index, precipitation, land surface temperature, elevation, and population density. Trend analysis, spatial autocorrelation, and standard deviation ellipse were employed to analyze the spatiotemporal distributions of carbon emission during 2012-2019. Three metrics (R2, root mean square error, and mean absolute error) were adopted to validate the accuracy of the proposed model, with the values of 0.95, 1.30, and 0.58 million tons, respectively, demonstrating a comparable estimation performance. The results present that carbon emissions in Shaanxi Province rise from 256.73 in 2012 to 305.87 million tons in 2019, formatting two hotspots in Xi'an and Yulin city. The proposed model can estimate carbon emissions of Shaanxi Province at a finer scale with an acceptable accuracy, which can be efficiently applied in other spatial or temporal domains after being localized, providing technical supports for carbon reduction.
Assuntos
Carbono , Aprendizado de Máquina , Humanos , Carbono/análise , Cidades , Análise Espacial , Temperatura , China , Dióxido de Carbono/análise , Desenvolvimento EconômicoRESUMO
Image retrieval technology has emerged as a popular research area of China's development of cultural digital image dissemination and creative creation with the growth of the Internet and the digital information age. This study uses the shadow image in Shaanxi culture as the research object, suggests a shadow image retrieval model based on CBAM-ResNet50, and implements it in the IoT system to achieve more effective deep-level cultural information retrieval. First, ResNet50 is paired with an attention mechanism to enhance the network's capacity to extract sophisticated semantic characteristics. The second step is configuring the IoT system's picture acquisition, processing, and output modules. The image processing module incorporates the CBAM-ResNet50 network to provide intelligent and effective shadow play picture retrieval. The experiment results show that shadow plays on GPU can retrieve images at a millisecond level. Both the first image and the first six photographs may be accurately retrieved, with a retrieval accuracy of 92.5 percent for the first image. This effectively communicates Chinese culture and makes it possible to retrieve detailed shadow-play images.
RESUMO
The aim of this study was to assess the occurrence level, spatial distribution, pollution source, and ecological risk of polycyclic aromatic hydrocarbons (PAHs) in the Kuye River of the northern Shaanxi mining area. In total, 16 priority PAHs were quantitatively detected at 59 sampling sites using a high-performance liquid chromatography-diode array detector in series with a fluorescence detector. The results showed that the ρ(ΣPAHs) in the Kuye River ranged from 50.06 to 278.16 ng·L-1, with an average value of 128.22 ng·L-1. The PAHs monomer concentrations ranged from 0 to 121.22 ng·L-1, of which Chrysene had the highest concentration, with average values of 36.58 ng·L-1, respectively, followed by benzo(a)anthracene and phenanthrene. The detection rate of each monomer was more than 70%, of which 12 monomers revealed detection rates of 100%. In addition, the 4-ring PAHs showed the highest relative abundance in the 59 samples, ranging from 38.59% to 70.85%. The PAHs concentrations revealed significant spatial variation in the Kuye River. Moreover, the highest PAHs concentrations were mainly observed in coal mining, industrial, and densely populated areas. Compared with those in other rivers in China and worldwide, the PAHs concentrations in the Kuye River showed a medium pollution level. On the other hand, the positive definite matrix factorization (PMF) and diagnostic ratios were used to quantitatively assess the source apportionment of PAHs in the Kuye River. The results showed that coking and petroleum emissions, coal combustion, fuel-wood combustion, and automobile exhaust emissions contributed to the PAHs concentrations in the industrial areas of the upper reach by 34.67%, 30.62%, 18.11%, and 16.60%, and coal combustion, fuel-wood combustion, and automobile exhaust emissions contributed in the downstream residential areas by 64.93%, 26.20%, and 8.86%. In addition, the results of the ecological risk assessment showed low ecological risks of naphthalene and high ecological risks of benzo(a)anthracene, respectively, whereas the remaining monomers revealed medium ecological risk. Among the 59 sampling sites, only 12 belonged to low ecological risk areas, whereas the remaining sampling sites were at medium to high ecological risks. Moreover, the water area near the Ningtiaota Industrial Park showed a risk value close to the high ecological risk threshold. Therefore, it is urgent to formulate prevention and control measures in the study region.
RESUMO
Exploring the process of carbon emissions under the "carbon peaking and carbon neutrality goals" can contribute to sustainable economic development. This research takes Shaanxi Province as an example. We elaborated on the spatial and temporal characteristics of land-use change from 2000 to 2020 and adopted the carbon emission model method to calculate land-use carbon emissions, also used urban morphological indicators to reveal the main factors of carbon emission changes. The results show that from 2000 to 2020, the land-use change in Shaanxi Province is mainly reflected in the increase in construction land area and the decrease in agricultural land area. Among them, the construction land area increased by 2192 km2, and the agricultural land area decreased by 5006 km2. Land-use carbon emissions increased by 1.28 × 1011 kg during this period. Construction land is a major contributor to carbon emissions. The forestland is the main carbon sink. Carbon emissions showed a spatial pattern of "high in the north, low in the south, and concentrated in the middle." Urban form change is the driving factor affecting land-use carbon emissions in Shaanxi Province. The results of the research contribute to the understanding of regional carbon emission mechanisms and provide a scientific basis for reducing carbon emissions.
Assuntos
Carbono , Florestas , Carbono/análise , Agricultura , Desenvolvimento Econômico , Sequestro de Carbono , China , Dióxido de CarbonoRESUMO
Based on the literature review, this paper analyzes how social capital and class identity influence peasants' behavior in household garbage sorting and recycling. We carried out field study in Shaanxi Province, China and collected 686 valid questionnaires as basic data for this study. The empirical results of Logit regression model indicate that social network, social prestige and social engagement are all positively correlated with household garbage sorting and recycling behavior of peasants, and class identity is also positively correlated with household garbage sorting and recycling behavior of peasants. The results also show that smaller families are more likely to carry out garbage sorting and recycling. In addition, we also found that class identity moderates the relationship between social trust and household garbage sorting and recycling behavior of peasants. Finally, the theoretical and practical significance, limitations of the study, and future directions are discussed.
Assuntos
Resíduos de Alimentos , Capital Social , Humanos , Reciclagem , Características da Família , ChinaRESUMO
Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.
RESUMO
Accurate identification of priority areas for ecological restoration is an important prerequisite for ecological protection and restoration, but it is a current challenge in landscape planning. Northern Shaanxi, which is located in the middle of the Loess Plateau in China, was selected as a study area in this paper. A three-dimensional framework including natural potential, human disturbance, and landscape pattern factors was used to construct an ecological security evaluation index system, and spatial principal component analysis (SPCA) was used to quantitatively evaluate the ecological security levels of the study area. The ecological security assessment result was used as a resistance surface, and landscape elements were identified by morphological spatial pattern analysis (MSPA), minimum cumulative resistance (MCR) model and the gravity model. On this basis, priority areas for ecological restoration were identified by considering ecosystem security and the matching degree of landscape elements. The resulting area with low and moderately low security levels was 27,574.87 km2 in size, accounting for 34.48% of the total study area, and the ecological security situation was not ideal. We identified seventeen ecological sources with an area of 5789.36 km2, and the important ecological sources were mainly distributed in the south of the study area. We identified one hundred and thirty-six potential ecological corridors with a total length of 7431.12 km, including 16 important ecological corridors with a length of 1279.43 km. We also identified 83 ecological nodes, including 17 important ecological nodes. We found that the high matching degree of landscape elements included four watersheds with an area of 7571.17 km2, mainly distributed in the southern part of the study area. Fifty-one basins with a low matching degree of landscape elements were identified, covering an area of 50,399.44 km2 and mainly distributed in the west and north of the study area. We identified three levels of areas to be restored, of which the level I ecological restoration priority area was the smallest, at 7047.61 km2. The areas of the level II ecological restoration priority area and the level III ecological restoration priority area were 20,379.35 km2 and 27,866.35 km2, respectively. The two areas were large and mainly distributed in the west and north of the study area. We discussed ecological restoration strategies for different levels of ecological restoration priority areas and provided new methods for identifying priority ecological restoration areas in the future.
Assuntos
Conservação dos Recursos Naturais , Ecossistema , Humanos , China , Análise Espacial , Análise de Componente Principal , EcologiaRESUMO
【Objective】 To analyze the epidemiological characteristics of pertussis in Shaanxi Province from 2012 to 2021. 【Methods】 We collected the information of pertussis cases in Shaanxi Province from 2012 to 2021 by the China Disease Control and Prevention Information System for analyzing the incidence and distribution characteristics. 【Results】 From 2012 to 2021, a total of 8270 cases of pertussis were reported in Shaanxi Province, with the incidence ranging from 0.21 to 6.20 per 100 000 persons, and for an annual average incidence of 2.17 per 100 000 persons. 44.81% (3 706/8 270) occurred from June to September. The annual average incidence in southern Shaanxi, Guanzhong, and northern Shaanxi was 1.78, 2.47, and 1.46 per 100 000 persons (χ2=289.638, P<0.001). The number of patients (proportions) with pertussis aged 0-1, 1-5, 5-10, and ≥10 years was 3 884 (46.96%), 2 869 (34.69%), 1 408 (17.03%), and 109 (1.32%), respectively. The number of patients (proportion) ≤ 2 months old, 3-5 months old, and ≥ 6 months old was 884 (22.76%),1 608 (41.40%), and 1 392 (35.84%) among pertussis patients under 1 year old. 【Conclusion】 The incidence of pertussis in Shaanxi Province basically showed an increasing trend with higher rates between June and September, higher rates in Guanzhong region of the province, and more patients over 5 years old.