RESUMO
OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.
RESUMO
Objective To observe the change in IL-1β,IL-13mRNA expression in drowning rat lungs and serum,so as to investigate the significance of IL-1β and IL-13 mechanism in the development of drowning.Methods SD rats were randomly divided into control group,drowning group.Then using TaqMan probe method to determine the expression of IL-1β and IL-13 mRNA in Right lower lobe of lung tissue and the serum of right ventricle,which were extracted respectively from each group of rats.Results (1) The lung tissue morphological changes:Typical appearance signs and anatomy of drowning group meet ante-mortem drowning feature.(2) The expression of IL-1β,IL-13 in lung tissue:compared with the control group,the expression of IL-1β and IL-13 were slightly decreased,which has no statistical significance.(3) The expression of IL-1β and IL-13 in serum:compared with the control group,the expression of IL-1β and IL-13 were significant increased,both of which has statistical significance.Conclusion (1)The expression of IL-1β and IL-13 were decreased in lung tissue may be due to drowned rats present compensatory anti-inflammatory response syndrome which causes immune incompetent performance.(2) The expression of IL-1β and IL-13 were significant increased in serum may be relate to drown stress and drowning associated acute lung injury after traumatic stress.