Water deficit and aphid resilience on wheat: examining Sitobion avenae F. and their bacterial symbionts interplay under controlled laboratory conditions.

BACKGROUND: Climate change has far-reaching effects on food security and agriculture, affecting crop yields and food distribution. Agriculture relies heavily on water for irrigation and production, making it vulnerable to water scarcity. Additionally, climate change can affect crop pest insects, leading to increased global crop losses, particularly in cereals, an important component of the human diet. Aphids are major crop pests and have a symbiotic relationship with bacterial endosymbionts that can contribute to their success as pests under a climate change scenario. To test the effect of drought on aphids, we examined varying levels of water deficit and endosymbiont composition on the grain aphid (Sitobion avenae) performance on wheat under controlled laboratory conditions. We measured the intrinsic rate of population increase (rm), the body weight of adult aphids, and the pre-reproductive period for different genotypes of the grain aphid (including Chilean superclones) under different irrigation regimes. We also analyzed the relative abundance of their endosymbionts under the different water treatments. RESULTS: Our findings revealed that water deficit affects each aphid genotype differently, impacting various traits. For instance, the body weight of adult aphids was notably affected by different water treatments, with aphids grown under intermediate water deficit (IW) being significantly bigger. The relative abundance of endosymbionts also varied among genotypes and water treatments-specifically Regiella insecticola had a noticeably higher abundance under IW (P < 0.05). CONCLUSION: This study provides valuable insights into the impact of water deficit on aphid performance and the role of endosymbionts in mitigating the effects of water deficit. © 2024 Society of Chemical Industry.

A deep learning approach for deriving wheat phenology from near-surface RGB image series using spatiotemporal fusion.

Accurate monitoring of wheat phenological stages is essential for effective crop management and informed agricultural decision-making. Traditional methods often rely on labour-intensive field surveys, which are prone to subjective bias and limited temporal resolution. To address these challenges, this study explores the potential of near-surface cameras combined with an advanced deep-learning approach to derive wheat phenological stages from high-quality, real-time RGB image series. Three deep learning models based on three different spatiotemporal feature fusion methods, namely sequential fusion, synchronous fusion, and parallel fusion, were constructed and evaluated for deriving wheat phenological stages with these near-surface RGB image series. Moreover, the impact of different image resolutions, capture perspectives, and model training strategies on the performance of deep learning models was also investigated. The results indicate that the model using the sequential fusion method is optimal, with an overall accuracy (OA) of 0.935, a mean absolute error (MAE) of 0.069, F1-score (F1) of 0.936, and kappa coefficients (Kappa) of 0.924 in wheat phenological stages. Besides, the enhanced image resolution of 512 × 512 pixels and a suitable image capture perspective, specifically a sensor viewing angle of 40° to 60° vertically, introduce more effective features for phenological stage detection, thereby enhancing the model's accuracy. Furthermore, concerning the model training, applying a two-step fine-tuning strategy will also enhance the model's robustness to random variations in perspective. This research introduces an innovative approach for real-time phenological stage detection and provides a solid foundation for precision agriculture. By accurately deriving critical phenological stages, the methodology developed in this study supports the optimization of crop management practices, which may result in improved resource efficiency and sustainability across diverse agricultural settings. The implications of this work extend beyond wheat, offering a scalable solution that can be adapted to monitor other crops, thereby contributing to more efficient and sustainable agricultural systems.

Transcription factor gene TaWRKY76 confers plants improved drought and salt tolerance through modulating stress defensive-associated processes in Triticum aestivum L.

WRKY transcription factor (TF) family acts as essential regulators in plant growth and abiotic stress responses. This study reported the function of TaWRKY76, a member of WRKY TF family in Triticum aestivum L., in regulating plant osmotic stress tolerance. TaWRKY76 transcripts were significantly upregulated upon drought and salt signaling, with dose extent- and stress temporal-dependent manners. Plant GUS activity assays suggested that stress responsive cis-acting elements, such as DRE and ABRE, exert essential roles in defining gene transcription under osmotic stress conditions. The TaWRKY76 protein targeted onto nucleus and possessed ability interacting with TaMYC2, a MYC TF member of wheat. TaWRKY76 and TaMYC2 positively regulated plant drought and salt adaptation by modulating osmotic stress-related physiological indices, including osmolyte contents, stomata movement, root morphology, and reactive oxygen species (ROS) homeostasis. Yeast one-hybrid assay indicated the binding ability of TaWRKY76 with promoters of TaDREB1;1, TaNCEB3, and TaCOR15;4. ChIP-PCR analysis confirmed that the osmotic stress genes are transcriptionally regulated by TaWRKY76. Moreover, the transgenic lines with knockdown of these stress-response genes displayed lowered plant biomass together with worsened root growth traits, decreased proline contents, and elevated ROS amounts. These results suggested that these stress defensive genes contributed to TaWRKY76-modulated osmotic stress tolerance. Highly positive correlations were observed between yield and the transcripts of TaWRKY76 in a wheat variety panel under field drought condition. A major haplotype TaWRKY76 Hap1 conferred improved drought tolerance. Our results suggested that TaWRKY76 is essential in plant drought and salt adaptation and a valuable target for molecular breeding stress-tolerant cultivars in Triticum aestivum L..

Physio-biochemical mechanism of melatonin seed priming in stimulating growth and drought tolerance in bread wheat.

Drought stress (DS) adversely affects a plant's development and growth by negatively altering the plant's physio-biochemical functions. Previous investigations have illustrated that seed priming with growth regulators is an accessible, affordable, and effective practice to elevate a plant's tolerance to drought stress. Melatonin (MT) is derived from the precursor tryptophan and can improve germination, biomass, and photosynthesis under stress conditions. The current study examined the effect of melatonin seed priming on two wheat cultivars (Fakhar-e-Bhakkar and Akber-19) cultivated under severe drought conditions (35% FC). There were 6 levels of melatonin (i.e., M0 = control, M1 = 1 mg L- 1, M2 = 2 mg L- 1, M3 = 3 mg L- 1, M4 = 4 mg L- 1 and M5 = mg L- 1) which were used for seed priming. Our results confirmed that seed priming with M2 = 2 mgL- 1 concentration of MT alleviates the negative effects of DS by boosting the germination rate by 54.84% in Akber-19 and 33.33% in Fakhar-e-Bhakkar. Similarly, leaf-relative water contents were enhanced by 22.38% and 13.28% in Akber-19 and Fakhar-e-Bhakkar, respectively. Melatonin pre-treatment with 2 mgL- 1 significantly enhanced fresh and dry biomass of shoot and root, leaf area, photosynthetic pigments, osmoprotectants accumulation [total soluble proteins (TSP), total free amino acids (TFAA), proline, soluble sugars, glycine betaine (GB)] and lowered the amount of malondialdehyde (MDA) and hydrogen peroxide (H2O2) production by elevating antioxidants [Ascorbic acid, catalase (CAT), Phenolics, peroxidase (POD) and superoxide dismutase (SOD)] activity under drought stress (DS). Meanwhile, under control conditions (NoDS), the melatonin treatment M1 = 1 mgL- 1 effectively enhanced all the growth-related physio-biochemical attributes in both wheat cultivars. In the future, more investigations are suggested on different crops under variable agroclimatic conditions to declare 2 mgL- 1 melatonin as an efficacious amendment to alleviate drought stress.

A fungal endophyte induces local cell wall-mediated resistance in wheat roots against take-all disease.

Take-all disease, caused by the Ascomycete fungus Gaeumannomyces tritici, is one of the most important root diseases of wheat worldwide. The fungus invades the roots and destroys the vascular tissue, hindering the uptake of water and nutrients. Closely related non-pathogenic species in the Magnaporthaceae family, such as Gaeumannomyces hyphopodioides, occur naturally in arable and grassland soils and have previously been reported to reduce take-all disease in field studies. However, the mechanism of take-all protection has remained unknown. Here, we demonstrate that take-all control is achieved via local but not systemic host changes in response to prior G. hyphopodioides root colonisation. A time-course wheat RNA sequencing analysis revealed extensive transcriptional reprogramming in G. hyphopodioides-colonised tissues, characterised by a striking downregulation of key cell wall-related genes, including genes encoding cellulose synthases (CESA), and xyloglucan endotransglucosylase/hydrolases (XTH). In addition, we characterise the root infection biologies of G. tritici and G. hyphopodioides in wheat. We investigate the ultrastructure of previously described "subepidermal vesicles" (SEVs), dark swollen fungal cells produced in wheat roots by non-pathogenic G. hyphopodioides, but not by pathogenic G. tritici. We show that G. hyphopodioides SEVs share key characteristics of fungal resting structures, containing a greater number of putative lipid bodies and a significantly thickened cell wall compared to infection hyphae. We hypothesise that SEVs are fungal resting structures formed due to halted hyphal growth in the root cortex, perhaps as a stress response to locally induced wheat defence responses. In the absence of take-all resistant wheat cultivars or non-virulent G. tritici strains, studying closely related non-pathogenic G. hyphopodioides provides a much needed avenue to elucidate take-all resistance mechanisms in wheat.

Coexistence of Celiac Disease and Allergic Wheat Sensitivity: An Observational Study of Daily Clinical Practice.

INTRODUCTION: Although separate immunogenic mechanisms are involved, IgE-type sensitization to wheat and celiac disease (CD) may coexist. We observationally assessed the importance of this relationship in daily practice using CD and wheat sensitization screenings. METHODS: Celiac antibody (CA) screening and food prick tests (FPTs) were requested simultaneously from patients who presented to the Allergy Clinic between January 2022 and December 2023 and had any complaint accompanied by CD symptoms/findings (non-celiac group). Patients with positive CA (CA+) underwent endoscopy. As another group, FPT results were recorded for patients previously diagnosed with CD following a gluten-free diet (celiac group). RESULTS: In total, 169 patients (124 non-celiac and 45 celiac) were included in the study. Wheat prick positivity (WP+) was observed in 1 patient with CD. Among 65 WP+ patients without a CD diagnosis, 14 (20.3%) tested positive for CA+, and histopathology detected CD in 4 of these cases. Among the 59 WP- patients, 4 (8.8%) had CA+. The CA+ status of those with WP+ was significantly higher than those with WP- (p = 0.023). CONCLUSION: The 4 patients unaware of their CD exhibited WP+, with a higher rate of CA+ observed in the WP+ group. The association between WP+ and CA+ suggests that an impaired intestinal barrier may lead to simultaneous T helper 1 and 2 type inflammatory responses. Although different types of sensitization to the same food would not typically be expected, growing evidence indicates that this phenomenon does occur. Further studies are necessary to confirm these findings and to explore the underlying causes.

Establishing a novel covalent complex of wheat gluten with tea polyphenols: Structure, digestion, and action mechanism.

Plant-based proteins represent a more sustainable alternative, the approaches to modify and enhance their functionality and application are focused on. Covalent interaction could significantly modify the structure and function properties of protein. This study investigated the effects of covalent interaction between wheat gluten and tea polyphenols on the structure, aggregation, stability, and digestive properties of their covalent complex, as well as the possible action mechanism. The results showed that tea polyphenols could interact with gluten via covalent bonds (CN and/or CS), while tea polyphenols also acted as a bridge connecting gluten molecules, thus making covalent complex to show the larger particle sizes. This covalent interaction significantly changed the secondary structure, tertiary structure, and surface hydrophobicity of gluten. Moreover, covalent complex exhibited the high polyphenols bioaccessibility during in vitro digestion. The peptide bonds of covalent complex were mainly broken in gastric digestion, while the covalent bonds between tea polyphenols and gluten were completely destroyed in intestinal digestion. In addition, their digestates exhibited excellent antioxidant capability. All results suggest that wheat gluten have potential to prepare functional carrier for transporting active compounds and protecting them during digestion.

Diagnostic Decision Point for IgE-Mediated Wheat Allergy in Children.

The diagnostic decision point can help diagnose food allergies while reducing the need for oral food challenge (OFC) tests. We performed a multicenter survey of children aged 0-7 years from January 1, 2018 to March 31, 2022. A total of 231 children were recruited from 18 institutions. Wheat allergy (WA) or non-wheat allergy (NWA) was determined on the basis of OFC results and symptoms. There were no differences in age, sex, family history of allergy or allergic comorbidities between the WA and NWA groups. According to receiver operating characteristic analysis for wheat-specific immunoglobulin E (IgE), the optimal cutoff value, positive decision point, and negative decision point were 10.2, 33.5, and 0.41 kU/L, respectively. For the ω-5 gliadin-specific IgE, their values were 0.69, 3.88, and 0.01 kU/L, respectively. This new diagnostic decision point may be used to diagnose WA in Korean children.

Virulence variation and pathotypes of Zymoseptoria tritici isolates causing wheat leaf blotch in Oromia, Ethiopia.

Leaf blotch, caused by Zymoseptoria tritici, is a fungal disease that poses a severe threat to wheat production worldwide. Knowledge of virulence variability is crucial in choosing effective control measures. However, there have only been a few studies of the pathogenic variability and pathotypes within Ethiopian isolates. Hence, the objective of this study was to assess the virulence spectrum and variability of Z. tritici isolates. Forty-three isolates were tested for their virulence and pathotype against 7 wheat differential lines that have different resistance genes. A pathogenicity assay detected 41 differential line-specific virulent isolates among 301 interactions between a host and pathogen based on the percentage coverage of the leaf area by pycnidia. Some isolates were virulent against 50 %-60 % of the resistant genes, but most of them were virulent against some differential lines. Isolates such as EtA-11, EtSh-1, EtSh-2, EtSh-4, and EtA-19 expressed broad-spectrum virulence, highlighting that such isolates are useful for germplasm screening. The isolates were classified into 25 pathotypes, defined by their differential virulence responses. They were also assigned to two clusters according to their mean pycnidia percent. Pathotypes and principal component analysis detected 58.1 % and 62.2 % pathogenic diversity in Ethiopian isolates, respectively. The current findings provide information that breeders can use to identify and select more resistant varieties for farmers.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 µm (average 69.7 × 21.57 µm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

The influence of non-starch polysaccharides on the formation mechanism of wheat dough.

The study examined the effects of oat ß-glucan (OßG), chitosan (CTS), araboxylan (AX), and fructosan (FOS) on wheat dough formation. Adding 0-7 % OßG, AX, and FOS increased SS content, enhancing gluten stability. D-AX and D-FOS showed higher ß-sheet structures, higher air retention and gluten network, smaller pores and denser structures, higher elastic and viscosity moduli. Excessive OßG and CTS could reduce the dough stability, and ß-turn and ß-sheet ratios, respectively. Therefore, B-7AX and B-7FOS exhibited lower hardness indices during storage, leading to a smoother appearance and more orderly gas chamber distribution. The study provides a theoretical foundation for using non-starch polysaccharides in flour-based products.

Bioengineering for robust tolerance against cold and drought stresses via co-overexpressing three Cu-miRNAs in major food crops.

Environmental stresses threaten global food security by reducing major crop productivity. MicroRNAs (miRNAs), a class of small non-coding RNAs, function as master regulators of gene expression in plants. In this study, we co-overexpressed three copper-miRNAs (miR397, miR408, and miR528) in three major food crops (referred to as 3miR-OE), which simultaneously silenced several target laccase genes, resulting in reduced lignin contents but increased flavonoid metabolites. Importantly, we observed that, compared to wild-type and single miRNA overexpression lines, the 3miR-OE transgenic Japonica and Indica rice exhibited significantly enhanced tolerance against cold and drought stresses throughout the growth period. In addition, 3miR-OE transgenic maize and wheat also exhibited robust resistance to cold and water-deficit conditions, suggesting that co-overexpressing three Cu-miRNAs is a powerful tool for improving resilience to abiotic stresses across diverse crops. Altogether, we have developed a bioengineering strategy to maintain crop growth and yield under unfavorable environmental conditions.

Accumulation of nanoplastics by wheat seedling roots: Both passive and energy-consuming processes.

Nanoplastics can transfer from the environment to plants and potentially harm organisms. However, the mechanisms on how crop root systems absorb and transport nanoplastics are still unclear. Here, original and fluorescent labeled polystyrene and polyvinyl chloride nanoparticles (PS-NPs, PVC-NPs; 30 nm; 10 mg L-1) were employed to study the distribution and internalization pathways in wheat seedling roots. In the study, nanoplastics accumulated more in the root tip and surface, with PVC-NPs more prevalent than PS-NPs. After being treated with inhibitors (Na3VO4, chlorpromazine and amiloride), the nanoplastics mean fluorescence intensities were reduced by 4.0-51.1 %. During the uptake, both passive and energy-consuming pathways occurred. For the energy-consuming uptake pathway, macropinocytosis contributed more to cytoplasm than clathrin-mediated endocytosis. H+ influx was observed during nanoplastic transport into the cytoplasm, and the reduction in plasma membrane ATPase activity led to a decrease in nanoplastic internalization. These results elucidate the pathways of nanoplastics absorption and transport in wheat roots, provide crucial evidence for assessing nanoplastics' ecological risks and support the development of technologies to block nanoplastics absorption by crop roots, ensuring agricultural and ecosystem safety.

Gastrointestinal microbiota and metabolites responses to dietary cereal grains in an adult pig model.

Corn (C), wheat (W), and paddy rice (PR) are important energy sources and are commonly used in feed production for swine. This study mainly focuses on the variation and regularities of microbiota and metabolites in the gastrointestinal tract (GIT) of pigs in response to C, W, and PR. A total of 18 pigs were allotted into three dietary groups with six replicated pigs and received diets containing C, W, or PR as the sole energy source, respectively. The results showed that digestive parts significantly affected the diversity of microbial communities. Cereal grain sources significantly influenced the ß-diversity of microbial communities in the colon and rectum. Campylobacterota and Proteobacteria are mainly distributed in the duodenum, Lactobacillus in the jejunum, and Bacteroidota in the colon and rectum. The W diet increased the Bacteroidota, Spirochaetota, and Prevotellaceae_NK3B31_group abundances and showed the highest concentrations of all short-chain fatty acids (SCFAs) in the hindgut. Fibrobacterota, Bacteroidota, Spirochaetota, Prevotellaceae_NK3B31_group, Prevotella, and Treponema in the colon or rectum were positively correlated with acetate, propionate, butyrate, and total SCFAs. These findings suggested that aerobic bacteria and facultative anaerobes in the foregut will gradually be replaced by anaerobes in the hindgut. The W diet had the best fermentability and was beneficial to the colonization of microbial communities that mainly used carbohydrates. The hindgut flora of the PR diet group may be more balanced with fewer potential pathogenic bacteria. Many microbial communities have been identified to contribute positively to the SCFA production of the hindgut. Collectively, our study revealed the spatial variation regularities of GIT microbial communities in an adult pig model and provided new insights into GIT microbiota and responses of metabolites to cereal grain diets.

Mix and manage: Cultivar mixtures can maintain yield under high wheat blast disease pressure.

Originating in South America, wheat blast disease has spread to both Asia and Africa and is considered a significant threat to food security. Bangladesh experienced the first outbreak of wheat blast outside of the Americas in 2016. Shortly thereafter, the blast-resistant variety BARI Gom 33 was released. Seeds of this variety are however not as widely available as required, although the disease threat remains. While varietal mixtures have been shown to mitigate some symptoms and yield losses associated with other fungal diseases in wheat, there is a complete research gap on this topic as it pertains to wheat blast. As such, we evaluated the potential of using BARI Gom 33 as a component of a variety mixture under high disease pressure in Bangladesh. During three cropping seasons, blast symptoms and yield were determined in a field experiment for the highly blast-susceptible variety BARI Gom 26, the moderately susceptible BARI Gom 30, the resistant BARI Gom 33, and seven mixture combinations of the three varieties using artificial inoculation to increase disease pressure. In addition to wheat blast, Bipolaris leaf blight (BpLB) symptoms were observed and evaluated. While yields of the susceptible varieties were severely affected by blast even after fungicide application, disease-inflicted yield loss without fungicide was only 15% for sole BARI Gom 33 and did not differ significantly from yield losses in BARI Gom 33 and BARI Gom 30 mixtures. Furthermore, in the mixture containing 67% BARI Gom 33 and 33% BARI Gom 30, blast incidence and severity were reduced by 25% and 16%, respectively, in comparison to weighted values in sole stands. Conversely, mixing varieties tended to increase the symptoms of BpLB. Under high wheat blast pressure, fungicide protection against blast was relatively weak, underscoring the importance of resistant varieties. Although variety mixtures did not increase yield, the yield advantage of BARI Gom 33 was maintained when its seeds were mixed with the less resistant BARI Gom 30. This study confirms recommendations that farmers should use BARI Gom 33 as a first line of defense against wheat blast in Bangladesh. Yet where farmers cannot access sufficient BARI Gom 33 seed for planting, our data suggest that agricultural extension services can recommend this variety with non-resistant cultivars as interim strategy without significant risk of yield loss.

Genotypic variation in winter wheat for fusarium foot rot and its biocontrol using Clonostachys rosea.

Biological control to manage plant diseases is an environmentally friendly alternative to using chemical pesticides. However, little is known about the role of genetic variation in plants affecting the efficacy of biological control agents (BCAs). The aim of this study was to explore the genetic variation in winter wheat for disease susceptibility to fusarium foot rot caused by Fusarium graminearum and variation in biocontrol efficacy of the fungal BCA Clonostachys rosea to control the disease. In total, 190 winter wheat genotypes were evaluated under controlled conditions in two treatments, i.e. (i) F. graminearum (Fg) and (ii) F. graminearum infection on C. rosea treated seeds (FgCr). Alongside disease severity, plant growth-related traits such as shoot length and root length were also measured. Comparison of genotypes between the two treatments enabled the dissection of genotypic variation for disease resistance and C. rosea efficacy. The study revealed significant variation among plant genotypes for fusarium foot rot susceptibility and other growth traits in treatment Fg. Moreover, significant variation in C. rosea efficacy was also observed in genotype contrasts between the two treatments for all traits. Using a 20K marker array, a genome-wide association study was also performed. We identified a total of 18 significant marker-trait associations for disease resistance and C. rosea efficacy for all the traits. Moreover, the markers associated with disease resistance and C. rosea efficacy were not co-localized, highlighting the independent inheritance of these traits, which can facilitate simultaneous selection for cultivar improvement.

Cellulose fiber drainage improvement via citric acid crosslinking.

Wheat straw, as a non-wood fiber waste, is available worldwide and can be used in cellulosic matric production, promoting the application of sustainable materials. However, poor fiber properties and water drainage are the primary obstacles to its utilization. In this study, wheat straw pulp fibers were chemically crosslinked by citric acid (CA) in an environmentally friendly process. X-ray photoelectron spectroscopy and Fourier transform infrared spectra confirmed that the chemical treatment introduced carboxylic groups to cellulose fibers. Meanwhile, X-ray diffraction patterns showed that the crystallinity of cellulose was reduced. The average fiber length and water retention value of the pulp decreased with increasing CA dosage under the conditions of 3 mL/g CA4 (4 wt% CA), and the drainage performance of the cellulose pulp improved by 21 %. Also, the crosslinking of fibers contributed to the mechanical properties of the cellulosic matrix, increasing the dry and wet strength by 21 % and 282 %, respectively. These results demonstrated that citric acid could be a sustainable method for improving the properties of wheat straw fibers, thereby promoting its application in fabricating sustainable materials.

An effector protein of Fusarium graminearum targets chloroplasts and suppresses cyclic photosynthetic electron flow.

Chloroplasts are important photosynthetic organelles that regulate plant immunity, growth, and development. However, the role of fungal secretory proteins in linking the photosystem to the plant immune system remains largely unknown. Our systematic characterization of 17 chloroplast-targeting secreted proteins of Fusarium graminearum indicated that Fg03600 is an important virulence factor. Fg03600 translocation into plant cells and accumulation in chloroplasts depended on its chloroplast transit peptide. Fg03600 interacted with the wheat (Triticum aestivum L.) proton gradient regulation 5-like protein 1 (TaPGRL1), a part of the cyclic photosynthetic electron transport chain, and promoted TaPGRL1 homo-dimerization. Interestingly, TaPGRL1 also interacted with ferredoxin (TaFd), a chloroplast ferredoxin protein that transfers cyclic electrons to TaPGRL1. TaFd competed with Fg03600 for binding to the same region of TaPGRL1. Fg03600 expression in plants decreased cyclic electron flow (CEF) but increased the production of chloroplast-derived reactive oxygen species (ROS). Stably silenced TaPGRL1 impaired resistance to Fusarium head blight (FHB) and disrupted CEF. Overall, Fg03600 acts as a chloroplast-targeting effector to suppress plant CEF and increase photosynthesis-derived ROS for FHB development at the necrotrophic stage by promoting homo-dimeric TaPGRL1 or competing with TaFd for TaPGRL1 binding.

Small ubiquitin-like modifier protease gene TaDSU enhances salt tolerance of wheat.

To identify efficient salt-tolerant genes is beneficial for coping with the penalty of salt stress on crop yield. Reversible conjugation (sumoylation and desumoylation) of Small Ubiquitin-Like Modifier (SUMO) is a crucial kind of protein modifications, but its roles in the response to salt and other abiotic stress are not well addressed. Here, we identify salt-tolerant SUMO protease gene TaDSU for desumoylation from wheat, and analyze its mechanism in salt tolerance and evaluate its role in yield in saline-alkaline fields. TaDSU overexpression enhances salt tolerance of wheat. TaDSU overexpressors have lower Na+ but higher K+ contents and consequently higher K+ : Na+ ratios than the wild-type under salt stress. TaDSU interacts with transcriptional factor MYC2, reduces the sumoylation level of SUMO1-conjugated MYC2, and promotes its transcription activity. MYC2 binds to the promoter of TaDSU and elevates its expression. TaDSU overexpression enhances grain yield of wheat in the saline soil without growth penalty in the normal field. Especially, TaDSU ectopic expression also enhances salt tolerance of Arabidopsis thaliana, showing this SUMO protease allele has the inter-species role in the adaptation to salt stress. Thus, TaDSU is an efficient candidate gene for molecular breeding of salt-tolerant crops.

Soil application of FeCl3 and Fe2(SO4)3 reduced grain cadmium concentration in Polish wheat (Triticum polonicum L.).

BACKGROUND: Wheat is one of major sources of human cadmium (Cd) intake. Reducing the grain Cd concentrations in wheat is urgently required to ensure food security and human health. In this study, we performed a field experiment at Wenjiang experimental field of Sichuan Agricultural University (Chengdu, China) to reveal the effects of FeCl3 and Fe2(SO4)3 on reducing grain Cd concentrations in dwarf Polish wheat (Triticum polonicum L., 2n = 4x = 28, AABB). RESULTS: Soil application of FeCl3 and Fe2(SO4)3 (0.04 M Fe3+/m2) significantly reduced grain Cd concentration in DPW at maturity by 19.04% and 33.33%, respectively. They did not reduce Cd uptake or root-to-shoot Cd translocation, but increased Cd distribution in lower leaves, lower internodes, and glumes. Meanwhile, application of FeCl3 and Fe2(SO4)3 up-regulated the expression of TpNRAMP5, TpNRAMP2 and TpYSL15 in roots, and TpYSL15 and TpZIP3 in shoots; they also downregulated the expression of TpZIP1 and TpZIP3 in roots, and TpIRT1 and TpNRAMP5 in shoots. CONCLUSIONS: The reduction in grain Cd concentration caused by application of FeCl3 and Fe2(SO4)3 was resulted from changes in shoot Cd distribution via regulating the expression of some metal transporter genes. Overall, this study reports the physiological pathways of soil applied Fe fertilizer on grain Cd concentration in wheat, suggests a strategy for reducing grain Cd concentration by altering shoot Cd distribution.