Occurrence of Yam Mosaic Virus and Yam Mild Mosaic Virus on Dioscorea spp. Germplasm Collection in Cuba-Epidemiology of Associated Diseases.

Potyvirus diseases are one of the main challenges facing the production of yam (Dioscorea spp.). The objective of this study was to identify the potyviruses present in the Dioscorea spp. germplasm collection at Instituto de Investigaciones de Viandas Tropicales (INIVIT) to establish methodologies for the characterization of the associated diseases. For this purpose, immunochemical and molecular methods were used to identify the potyviruses present. The symptomatology of Dioscorea spp. at INIVIT's germplasm collection was described. In addition, the severity and incidence in the germplasm collection and production areas were evaluated. As a result, the first report of yam mosaic virus (Potyvirus yamtesselati) and yam mild mosaic virus (Potyvirus yamplacidum) in Cuba is presented. The existence of resistant, tolerant, and susceptible cultivars to potyvirus-associated diseases in the germplasm collection was detected, and the incidence of these diseases was higher than 64% in the production areas evaluated. This study represents a step forward in the establishment of certification programs for propagating material of Dioscorea spp. in Cuba.

Virus prevalence and mixed infections in yellow passion fruit (Passiflora edulis f. flavicarpa) crops in Valle del Cauca, Colombia / Prevalencia e infección mixta de virus en cultivos de maracuyá amarillo (Passiflora edulis f. flavicarpa) en el Valle del Cauca, Colombia

ABSTRACT Yellow passion fruit crop is affected by multiple phytosanitary problems. Among the main ones are viruses of the genera Potyvirus (soybean mosaic virus, SMV), Cucumovirus (cucumber mosaic virus, CMV), Tymovirus (tymovirus passiflorae, PYMV) and Begomovirus (passionfruit leaf distortion virus, PLDV). Information about the prevalence and interaction between these viruses is scarce. The objective of this study was to verify the prevalence and identify the types of mixed viral infections of potyvirus, cucumovirus, tymovirus, and begomovirus in passion fruit crops in Valle del Cauca, Colombia. Passion fruit leaf samples with symptoms were collected and their nucleic acids were purified. Virus identification was performed by PCR using universal primers by viral genus, and specific primers for the SMV, CMV, PFYMV and PLDV viruses. The incidence of each virus by municipality was analyzed and the severity of the symptoms was compared with the diagnosis made. In total, 66 samples were collected in the municipalities of Toro, Dagua, Roldanillo, Bolívar, La Unión and El Cerrito. It was established that the most prevalent viruses are PLDV followed by SMV and CMV. The presence of PYMV was not detected in the samples analyzed. The presence of double and triple infections among potyvirus, cucumovirus and begomovirus were identified for the first time, finding greater severity of symptoms with a greater number of viruses identified per sample. This research provides key results for the design of control strategies for viral diseases in passion fruit.

RESUMEN El cultivo de maracuyá amarillo es afectado por múltiples problemas fitosanitarios. Entre los principales, están los virus de los géneros Potyvirus (soybean mosaic virus, SMV), Cucumovirus (cucumber mosaic virus, CMV), Tymovirus (passion fruit yellow mosaic virus, PFYMV) y Begomovirus (passionfruit leaf distortion virus, PLDV). Información acerca de la prevalencia e interacción entre estos virus es escasa. El objetivo del presente estudio fue verificar la prevalencia e identificar los tipos de infecciones virales mixtas de potyvirus, cucumovirus, tymovirus y begomovirus en cultivos de maracuyá en Valle del Cauca, Colombia. Muestras foliares de maracuyá con síntomas virales fueron recolectadas y se purificaron sus ácidos nucleicos. La identificación de los virus se realizó por PCR empleando cebadores universales por género viral, y cebadores específicos para los virus SMV, CMV, PFYMV y PLDV. Se analizó la incidencia de cada virus por municipio y se comparó la severidad de los síntomas con el diagnóstico realizado. En total se colectaron 66 muestras en los municipios de Toro, Dagua, Roldanillo, Bolívar, La Unión y El Cerrito. Se estableció que los virus con mayor prevalencia fueron PLDV, seguido por SMV y CMV. No se detectó la presencia de PFYMV en las muestras analizadas. Se identificó por primera vez la presencia de infecciones dobles y triples entre potyvirus, cucumovirus y begomovirus, encontrándose mayor severidad de síntomas a mayor número de virus identificado por muestra. La presente investigación provee resultados clave para el diseño de estrategias de control de enfermedades virales en maracuyá.

Development of genetic stocks of sunflower with resistance to sunflower chlorotic mottle virus / Conformación de recursos genéticos de girasol con resistencia al virus del moteado clorótico del girasol

ABSTRACT The common race of sunflower chlorotic mottle virus (SCMoV-C) can cause severe yield losses in susceptible genotypes of sunflowers if infection occurs at early plant stages. In Argentina, SCMoV-C is widespread in sunflower production fields and even if its incidence is generally low, in some cases it can reach up to 95%. To date, no complete resistance to SCMoV-C has been detected in commercial cultivars. In the search for resistant germplasm, wild sunflower (Helianthus annuus L.) populations from Argentina were tested, as they were exposed to natural selective pressure during their naturalization. After artificial inoculation with SCMoV-C, symptom-free plants were selected and grown for controlled self-pollination, sibling crosses and crosses with inbred lines. Recurrent selection for non-symptomatic plants and self-fertility significantly increased the frequency of asymptomatic individuals after SCMoV-C inoculation in the development germplasm. After eight generations of recurrent selection and controlled crosses, four genetic stocks with complete SCMoV-C resistance were developed. These genetic stocks could be used for breeding programs and genetic studies. The genetic stocks were registered in the Active Sunflower Germplasm Bank of the National Institute of Agricultural Technology (INTA, EEA-Manfredi), for maintenance and public distribution.

RESUMEN En los genotipos susceptibles de girasol, la cepa común del Virus del moteado clorótico del girasol (SCMoV-C) puede causar graves pérdidas de rendimiento si la infección ocurre en las primeras etapas del desarrollo de la planta. En Argentina, el SCMoV-C está muy extendido en los campos de producción de girasol y aunque su incidencia es generalmente baja, en algunos casos puede llegar hasta el 95%. Hasta ahora, no se ha detectado resistencia completa a SCMoV-C en cultivares comerciales. En la búsqueda de germoplasma resistente, poblaciones de girasol silvestre (Helianthus annuus L.) de Argentina fueron testeadas, ya que durante su naturalización estuvieron expuestas a presión selectiva natural. Después de la inoculación artificial con SCMoV-C, se seleccionaron y cultivaron plantas libres de síntomas y se realizaron cruzamientos controlados, entre hermanos, con líneas endogámicas y autofecundaciones. La selección recurrente de plantas asintomáticas y autofértiles aumentaron considerablemente la frecuencia de individuos asintomáticos después de la inoculación con SCMoV-C en el germoplasma en desarrollo. Después de ocho generaciones de selección recurrente y cruces controlados, se desarrollaron cuatro stocks genéticos con resistencia completa a SCMoV-C. Este germoplasma podría utilizarse para programas de mejoramiento y estudios genéticos. Los stocks genéticos fueron registrados en el Banco de Germoplasma Activo de Girasol del Instituto Nacional de Tecnología Agropecuaria (INTA, EEA-Manfredi), para su mantenimiento y distribución pública.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

First report of sunflower chlorotic mottle virus infecting sunflower plants in Brazil

Sunflower (Helianthus annuus) plants showing symptoms of chlorosis, mosaic, chlorotic ringspot, and necrosis on younger leaves were found in a small experimental plot in Piracicaba, in the state of São Paulo, Brazil. Preliminary examinations by transmission electron microscopy of symptomatic leaf tissue revealed flexuous filamentous particles 13-15 nm wide and 700-750 nm long, and cytoplasmatic cylindrical inclusions typical of those found in plant cells infected by members of the Potyvirus genus. Total RNA extracted from symptomatic leaves and subjected to RT-PCR followed by partial nucleotide sequencing confirmed the presence of a potyvirus in the affected plants, which was identified as sunflower chlorotic mottle virus (SuCMoV), a member of the Sunflower chlorotic mottle virus (genus Potyvirus, family Potyviridae) species. Mechanical transmission assays with extracts of symptomatic sunflower leaves reproduced the original symptoms in sunflowers, mosaic symptoms in Zinnia elegans, and chlorotic local lesions in Chenopodium amaranticolor and C. quinoa. Sunflower and zinnia plants became infected after aphid transmission experiments with Myzus persicae. RT-PCR tests using specific primers for SuCMoV confirmed the presence of this virus in experimentally infected plants, meeting the criteria of Koch's postulate. This is the first report of SuCMoV infecting sunflower plants in Brazil.

Detección molecular de Cucumber mosaic virus y Pepper severe mottle virus en arvenses asociadas al cultivo de ají (Capsicum spp.)

En los últimos años, el ají (Capsicum chinense, Capsicum frutescens y Capsicum annuum var. Acuminatum), cultivado en el Valle del Cauca, se ha visto afectado por enfermedades virales causadas por Cucumber mosaic virus (CMV-ají) y Pepper severe mottle virus (PepSMoV). Pese a que estos dos virus son limitantes para producción del cultivo de ají, en la actualidad, pocos estudios han identificado los hospederos alternos de CMV-ají y PepSMoV. En este trabajo, se evaluó la presencia de CMV-ají y PepSMoV, mediante RT-PCR, en muestras de tejido foliar, de 121 plantas arvenses, asociadas al cultivo de ají, en el Valle del Cauca, Colombia. El análisis molecular indicó la presencia de CMV-ají, en el 21,4 % de las plantas recolectadas y de PepSMoV, en el 20,6 %. Se identificaron las especies arvenses Amaranthus viridis, Parthenium hysterophorus, Hippobroma longiflora, Commelina diffusa, Clitoria ternatea, Crotalaria incana, Desmodium tortuosum, Desmodium intortum, Macroptilium lathyroides, Anoda acerifolia, Boerhavia erecta, Bougainvillea glabra, Rivina humilis, Browallia americana, Capsicum rhomboideum, Solanum americanum y Lantana camara, como hospederas de CMV-ají o PepSMoV. Se presentó infección mixta de CMV-ají y PepSMoV, en 57 % de las arvenses positivas a virus, las cuales, están distribuidas en zonas productores de ají, localizadas en seis municipios del Valle del Cauca. Estos resultados brindan información sobre la distribución de estos virus en el Valle del Cauca, contribuyen al conocimiento de la epidemiología viral y servirán para diseñar medidas de manejo, orientadas a prevenir las infecciones virales en los cultivos de ají.

In recent years, chili pepper (Capsicum chinense, Capsicum frutescens y Capsicum annuum var. Acuminatum) grown in Valle del Cauca has been affected by viral diseases caused by Cucumber mosaic virus (CMV-chili pepper) and Pepper severe mottle virus (PepSMoV). Although these two viruses are limiting to the production of the chili pepper crop, at present, few studies have identified the alternate hosts of CMV-chili pepper and PepSMoV. In this work, the presence of CMV-chili pepper and PepSMoV were evaluated by RT-PCR in leaf tissue samples from 121 weed plants associated with chili pepper cultivation in Valle del Cauca, Colombia. Molecular analysis indicated the presence of CMV-chili pepper in 21.4 % of the collected plants and PepSMoV in 20.6 %. Weed species Amaranthus viridis, Parthenium hysterophorus, Hippobroma longiflora, Commelina diffusa, Clitoria ternatea, Crotalaria incana, Desmodium tortuosum, Desmodium intortum, Macroptilium lathyroides, Anoda acerifolia, Boerhavia erecta, Bougainvillea glabra, Rivina humilis, Browallia americana, Capsicum rhomboideum, Solanum americanum and Lantana camara, as hosts of CMV-chili pepper or PepSMoV. Mixed infection of CMV-chili pepper and PepSMoV was present in 57 % of the weeds positive for viruses, which are distributed in chili pepper producing areas located in six municipalities of Valle del Cauca. These results provide information on the distribution of these viruses in Valle del Cauca. Contribute to the knowledge of viral epidemiology and will serve to design management measures aimed to prevent viral infections in chili pepper crops.

Maize Lethal Necrosis disease: review of molecular and genetic resistance mechanisms, socio-economic impacts, and mitigation strategies in sub-Saharan Africa.

BACKGROUND: Maize lethal necrosis (MLN) disease is a significant constraint for maize producers in sub-Saharan Africa (SSA). The disease decimates the maize crop, in some cases, causing total crop failure with far-reaching impacts on regional food security. RESULTS: In this review, we analyze the impacts of MLN in Africa, finding that resource-poor farmers and consumers are the most vulnerable populations. We examine the molecular mechanism of MLN virus transmission, role of vectors and host plant resistance identifying a range of potential opportunities for genetic and phytosanitary interventions to control MLN. We discuss the likely exacerbating effects of climate change on the MLN menace and describe a sobering example of negative genetic association between tolerance to heat/drought and susceptibility to viral infection. We also review role of microRNAs in host plant response to MLN causing viruses as well as heat/drought stress that can be carefully engineered to develop resistant varieties using novel molecular techniques. CONCLUSIONS: With the dual drivers of increased crop loss due to MLN and increased demand of maize for food, the development and deployment of simple and safe technologies, like resistant cultivars developed through accelerated breeding or emerging gene editing technologies, will have substantial positive impact on livelihoods in the region. We have summarized the available genetic resources and identified a few large-effect QTLs that can be further exploited to accelerate conversion of existing farmer-preferred varieties into resistant cultivars.

Complete genome sequence of a recombinant isolate of yambean mosaic virus from Canavalia ensiformis.

The complete genome sequence of a Brazilian isolate of yambean mosaic virus (YBMV) is presented. High-throughput sequencing (Illumina HiSeq) and Sanger sequencing revealed the complete genome sequence of the YBMV-BRA-6 isolate, found in Canavalia ensiformis. The de novo contigs were assembled into a 9612 nucleotides (nt) long scaffold, excluding the 3'-terminal poly(A) tail, covering the complete genome. The genomic RNA contains an open reading frame (ORF) typical of members of the genus Potyvirus, family Potyviridae, encoding a large putative polyprotein of 3078 amino acids (aa) and a small overlapping PIPO ORF. Pairwise comparisons showed that the YBMV-BRA-6 isolate sequence shares 88.1% nt identity for the complete genome and 90.6% aa identity for the polyprotein with the YBMV-SR isolate. Phylogenetic analysis grouped both isolates together and close to bean common mosaic virus (BCMV). The polyprotein cleavage sites were predicted and a recombination event is described.

Diversity and Distribution of Viruses Infecting Wild and Domesticated Phaseolus spp. in the Mesoamerican Center of Domestication.

Viruses are an important disease source for beans. In order to evaluate the impact of virus disease on Phaseolus biodiversity, we determined the identity and distribution of viruses infecting wild and domesticated Phaseolus spp. in the Mesoamerican Center of Domestication (MCD) and the western state of Nayarit, Mexico. We used small RNA sequencing and assembly to identify complete or near-complete sequences of forty-seven genomes belonging to nine viral species of five genera, as well as partial sequences of two putative new endornaviruses and five badnavirus- and pararetrovirus-like sequences. The prevalence of viruses in domesticated beans was significantly higher than in wild beans (97% vs. 19%; p < 0.001), and all samples from domesticated beans were positive for at least one virus species. In contrast, no viruses were detected in 80-83% of the samples from wild beans. The Bean common mosaic virus and Bean common mosaic necrosis virus were the most prevalent viruses in wild and domesticated beans. Nevertheless, Cowpea mild mottle virus, transmitted by the whitefly Bemisia tabaci, has the potential to emerge as an important pathogen because it is both seed-borne and a non-persistently transmitted virus. Our results provide insights into the distribution of viruses in cultivated and wild Phaseolus spp. and will be useful for the identification of emerging viruses and the development of strategies for bean viral disease management in a center of diversity.

Molecular insights on potato yellow vein crinivirus infections in the highlands of Colombia.

Potato yellow vein virus (PYVV) was detected in potatoes grown in the Central highlands, north of Bogotá (~3000 m altitude), Colombia. At this altitude viral whitefly vectors are largely absent, but infection persists because of the use of uncertified tubers. Plants with typical PYVV-induced yellowing symptoms, as well as with atypical yellowing or non-symptomatic symptoms were sampled at three separate geographical locations. PYVV presence was assessed by RT-PCR, and several plants were subjected to high-throughput sequencing (HTS) of their small RNA (sRNA) populations. Complete or almost complete sequences of four PYVV isolates were thus reconstructed, all from symptomatic plants. Three viral isolates infected plants singly, while the fourth co-infected the plant together with a potyvirus. Relative proportions of sRNAs to each of the three crinivirus genomic RNAs were found to remain comparable among the four infections. Genomic regions were identified as hotspots of sRNA formation, or as regions that poorly induced sRNAs. Furthermore, PYVV titres in the mixed versus single infections remained comparable, indicating an absence of synergistic/antagonistic effects of the potyvirus on the accumulation of PYVV. Daughter plants raised in the greenhouse from tubers of the infected, field-sampled plants displayed mild PYVV infection symptoms that disappeared with time, demonstrating the occurrence of recovery and asymptomatic infection phenotypes in this pathosystem.

First report of costus stripe mosaic virus infecting Tradescantia spathacea plants in Brazil.

Tradescantia spathacea (family Commelinaceae) is cultivated worldwide as an ornamental (Golczyk et al., 2013) and as medicinal plant (Tan et al., 2020). In 2019, 90 of ~180 plants of T. spathacea, grown in two beds of 4 m2 and exhibiting leaf mosaic were found in an experimental area at ESALQ/USP (Piracicaba municipality, São Paulo state, Brazil). Potyvirus-like flexuous filamentous particles were observed by transmission electron microscopy in foliar extracts of two symptomatic plants stained with 1% uranyl acetate. Total RNA was extracted using the Purelink viral RNA/DNA kit (Thermo Fisher Scientific) from leaves of two symptomatic plants and separately subjected to a reverse transcription polymerase chain reaction (RT-PCR). The potyviruses degenerate pairs of primers CIFor/CIRev (Ha et al. 2008), which amplifies a fragment corresponding to part of the cylindrical inclusion protein gene, and WCIEN/PV1 (Maciel et al. 2011), which amplifies a fragment containing part of the capsid protein gene and the 3' untranslated region, were used. The expected amplicons (~700bp) were obtained from both total RNA extracts. Two amplicons from one sample were purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega) and directly sequenced in both directions at Macrogen Inc (Seoul, South Korea). The obtained nucleotide sequences (GenBank MW430005 and MW503934) shared 95.32% and 97.79% nucleotide identity, respectively, with the corresponding sequences of the Brazilian isolate of the potyvirus costus stripe mosaic virus (CoSMV, MK286375) (Alexandre et al. 2020). Extract from an infected plant of T. spathacea was mechanically inoculated in 10 healthy plants of T. spathacea and two plants each of the following species: Capsicum annuum, Chenopodium amaranticolor, Commelina benghalensis, Datura stramonium, Gomphrena globosa, Nicandra physaloides, Nicotiana tabacum cvs. Turkish and Samsun, Solanum lycopersicum, T. palida, and T. zebrina. All T. spathacea plants exhibited mosaic and severe leaf malformation. C. benghalensis plants developed mild mosaic, whereas infected T. zebrina plants were asymptomatic. The plants of other species were not infected. RT-PCR with specific CoSMV primers CoSMVHC-F and CoSMVHC-R (Alexandre et al. 2020) confirmed the infection. Nucleotide sequences of amplicons obtained from experimentally inoculated T. spathacea and T. zebrina (MW430007 and MW430008) shared 94.56% and 94.94% identity with the corresponding sequence of a Brazilian CoSMV isolate (MK286375). None of eight virus-free plants of T. spathacea inoculated with CoSMV using Aphis craccivora exhibited symptoms, nor was CoSMV detected by RT-PCR. Lack of CoSMV transmission by A. solanella, Myzus persicae, and Uroleucon sonchi was previously reported (Alexandre et al. 2020). T. spathacea plants are commonly propagated vegetatively, and by seeds. Virus-free seeds, if available, can provide an efficient and easy way to obtain healthy plants. Only three viruses were reported in plants of the genus Tradescantia: Commelina mosaic virus, tradescantia mild mosaic virus, and a not fully characterized potyvirus (Baker and Zettler, 1988; Ciuffo et al., 2006; Kitajima 2020). CoSMV was recently reported infecting Costus spiralis and C. comosus (Alexandre et al. 2020). As far as we know, this is the first report of CoSMV infecting T. spathacea plants.

First report of Colombian datura virus in Brugmansia suaveolens in Korea.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

Strongylodon macrobotrys: new host of soybean mosaic virus in Brazil.

Strongylodon macrobotrys, commonly known as the jade vine, emerald vine, or turquoise jade vine, is a species of Fabaceae native to the Philippines. The plants have blue-green color inflorescences, which makinge them one of the most admired ornamental plants in Brazil (Muniz et al. 2015). In addition, the plants contain compounds with anticancer properties (Ragasa et al. (2014) isolated compounds from S. macrobotrys with anticancer properties. In March 2019, an adult jade plant, grown under the trellis system in an experimental area at the campus of the University of São Paulo (USP), Piracicaba, state of São Paulo, was found showing mosaic symptoms typical of a virus infection. Preliminary examination of negatively stained leaf extracts by transmission electron microscopy detected elongated, flexuous particles similar tolike thoseat of a potyviruses. Further observations of thin sections of symptomatic leaf tissues revealed the presence of cylindrical inclusions, as well as bundles of thin, elongated, and filamentous particles, typical of potyvirus infection in epidermal, parenchymalparenchymal, and vascular regions, as well as bundles of thin, elongated and filamentous particles. Subsequent molecular and biological assays confirmed the presence of a potyvirusTo identify the species of the virus, .Presence of a potyvirus was confirmed by subsequent molecular and biological assays. Ttotal RNA was extracted from a pool of symptomatic leaves from the plant using the Purelink viral RNA/DNA kit (Thermo Fisher Scientific), and analyzed by one- step RT-PCR using potyviruses universal primers PV1/SP6 and WCIEN-sense (Mackenzie et al. 1998; Maciel et al. 2011), which amplify a 750-bp fragment. Total RNA extracted from an asymptomatic jade vine, obtained from a florist shop, was used as a negative controlincluded in the assay. PCR products at the expected size (~750-bp) were observed in the symptomatic plant but not in the asymptomatic plant. BLASTn analysis of the Nnucleotide sequence of the amplicon obtained only from total RNA of the symptomatic plant (GenBank accession no. MN970030) showed that it shares 90.82% to 97.859% identity with corresponding nucleotide sequences of the Korean isolate WS162 of soybean mosaic virus (SMV) deposited at the GenBank (, accession no. FJ640973, FJ640956, D88616). Extracts from symptomatic leaves of the jade plant wereas mechanically inoculated onto leaves of healthy plants of jade vine, Jack bean (Canavalia ensiformis), soybean cv. NA 5909 (Glycine max), cowpea (Vigna unguiculata), and passion fruit (Passiflora edulis f. flavicarpa). One plant of jade plant and four plants of each other species were inoculated , and infection was assessed based and monitored for symptom expression on symptom expression, and RT-PCR. The jade vine and Jack bean plants were infected by SMV, showingdeveloped mild mosaic symptoms approximately 60 and 15 days after inoculation, respectively , whereas the plants of other species were absent of any visible symptoms . To confirm the potyvirus identity, the jade vine samples were also tested by cConventional RT-PCR with SMV-specific primers pairs CP-F-SMV/CP-R-SMV (Jaramillo Mesa et al., 2018) and SMV-CPf/SMV-CPr (Wang and Ghabrial, 2002), thawhicht amplify fragments of 1000 990-bp and 469-bp90, respectively, nucleotides offrom the CP geneome region of SMV was performed, respectively. Amplicons of expected sizes were obtained from the total RNA of the leaves of field-infected and the mechanically inoculated plant of jade plantsvine as well as the Jack bean plants, but not from the asymptomatic jade plantvine and plants of other species the negative control. The viral nucleotide sequences obtained with the above pairs of primersBLASTn analysis of nucleotide sequences of the amplicons showed that they share 96.81% and 97.63% identity, respectively, with the same Korean SMV isolate WS162. These results demonstrate that… the field-symptomatic jade vine was infected with SMV, which is naturally transmitted by aphids speciess in a non-persistent manner and via soybean infected seeds (Hajimorad et al. 2018)( ). The virus appears to have has a restricted narrow natural host range., Aapart from soybean, and to date, it has only been reported the natural infection has been documented only in soybean, Lagenaria siceraria, Passiflora spp., Pinellia ternata, Senna occidentalis, and Vigna angularis (Almeida et al., 2002; Chakraborty et al. 2016; Hajimorad et al. 2018). To our knowledge, this is the first report of SMV in S. macrobotrys in the world. Further surveys are necessary to determine the incidence of the virus in ornamental jade plants vines and its importance as virus reservoirs for commercial soybean crops.

First report of bidens mosaic virus infecting Centella asiatica in Brazil.

Centella asiatica is a perennial, herbaceous creeper plant that belongs to the family Apiaceae. It has been known since prehistoric times and has been used for therapeutic and cosmetic purposes (James and Dubery 2009; Gohil et al. 2010), and is easily propagated vegetatively. In 2018, plants of C. asiatica exhibiting foliar symptoms of mosaic and malformation were found in the botanical garden of the Plantarum Institute (Nova Odessa municipality, São Paulo state - 22°46'45.8"S 47°18'47.5"W) and in an experimental area at ESALQ/USP (Piracicaba municipality, São Paulo state - 22°42'26.0"S 47°37'48.6"W). In both locations the plants were grown in beds of approximately 4 m2 and all of them were symptomatic. Initially, leaf extract from symptomatic C. asiatica plants was examined by transmission electron microscopy (TEM) after being negatively stained with 1% uranyl acetate. Potyvirus-like flexuous filamentous particles were observed in leaf samples from both locations. TEM of thin sections of symptomatic leaf tissues revealed the presence of cylindrical inclusions, characteristic of infection by potyviruses, in the cytoplasm of epidermal, parenchymal, and vascular cells. Total RNA was extracted from symptomatic leaves collected in the Plantarum Institute (3 samples), and at Escola Superior de Agricultura Luiz de Queiroz (1 sample) using the Purelink viral RNA/DNA kit (Thermo Fisher Scientific, Waltham, USA). Reverse Transcription -Polymerase Chain Reaction (RT-PCR) was performed using the degenerate primers CIFor (5'-GGIVVIGTIGGIWSIGGIAARTCIAC-3') and CIRev (5'-ACICCRTTYTCDATDATRTTIGTIGC-3'), which amplify a fragment of approximately 700 bp within the the cylindrical inclusion protein gene of potyviruses (Ha et al. 2008). Amplicons of the expected size were obtained for all four samples analysed. One amplicon per location was purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega), and directly sequenced in both directions at Macrogen Inc (Seoul, South Korea). The nucleotide sequences obtained from the symptomatic C. asiatica plants collected in the Plantarum Institute (GenBank Acc. No. MT668627), and at ESALQ/USP (GenBank Acc. No. MT668626) showed 97.1% and 96.2% identity, respectively, with the nucleotide sequence of a Brazilian isolate of bidens mosaic virus (BiMV), family Potyviridae, genus Potyvirus (GenBank Acc. No. KF649336). To confirm the infection of C. asiatica plants with BiMV, the previously extracted RNAs were analyzed by RT-PCR using the specific primers 8331 (5'-CGTGGGGCTATCCTGAATTG-3') and 9046 (5'-CCACATCAGAGAAGTGTGCC-3'), which amplify a fragment of 715 bp corresponding to the BiMV coat protein gene (Suzuki et al. 2009). The expected size amplicons were obtained for all four samples of symptomatic plants of C. asiatica. The nucleotide sequences of two amplicons (GenBank Acc. Nos. MT668628, and MT668629), representing plants from each location, showed 94.6% to 95.6% identities with corresponding nucleotide sequences of the coat protein gene of BiMV from Brazil (GenBank Acc. Nos. KF649336, AY960150, and AY960151). A leaf extract of a symptomatic C. asiatica plant was mechanically inoculated to healthy plants of Apium graveolens, Bidens pilosa, C. asiatica, Chenopodium amaranticolor, C. quinoa, Coriander sativum, Nicotiana benthamiana, N. tabacum and Petroselinum crispum. C. asiatica became systemically infected, reproducing the original symptoms of leaf mosaic and malformation. N. benthamiana was infected and developed severe mosaic symptoms, whereas C. amaranticolor and C. quinoa reacted only with necrotic and chlorotic local lesions, respectively. Other assayed plants were not infected. Potyvirus-like particles were observed by TEM in the infected plants and BiMV infection was confirmed by RT-PCR. Transmission assays of the BiMV isolate by aphids Myzus persicae and Aphys gossypii to healthy C. asiatica plants were also performed. Virus-free aphids of the two species, reared on Capsicum annuum and Gossypium hirsutum respectively, were fasted for 30 min and then placed, separately, on symptomatic leaves of C. asiatica for an acquisition access period (AAP) of 10 min. After that, groups of six insects were transferred, separately, to four healthy C. asiatica plants for an inoculation access period (IAP) of 24 h. After inoculation the insects were killed manually. Approximately 30 days later, one plant inoculated with each species of aphid exhibited symptoms and infection was confirmed by RT-PCR and nucleotide sequencing of the amplicons. BiMV was absent in control, non-inoculated plants in both mechacial and aphid transmission assays. Infection of spontaneously growing C. asiatica plants by potyvirus, determined by TEM, was previously reported in Curitiba and Colombo, state of Paraná, Brazil by Lima Neto and Souza (1981), but the virus was not fully characterized and identified. In addition to BiMV, plants of C. asiatica are also suscptible to infection with cucumber mosaic virus (CMV), as reported by Cardin and Moury (2010) in Madagascar. This is the first identification of BiMV naturally infecting C. asiatica. Additional works on effects of BiMV infection of C. asiatica on commercial production and pharmaceutical properties are required.

Ocurrence of pepper yellow mosaic virus and cucumber mosaic virus on Capsicum chinense in the state of Amazonas, Brazil / Ocorrência do pepper yellow mosaic virus e cucumber mosaic virus em Capsicum chinense no estado do Amazonas, Brasil

The habanero chilli pepper, Capsicum chinense is an important crop in the Amazon Basin, mainly grown by small-scale producers. Capsicum chinense plants in an experimental field in the northern Brazilian state of Amazonas were found exhibiting characteristic symptoms of viral infection. Leaf sap from symptomatic plants examined under a transmission electron microscope revealed the presence of elongated flexuous particles and isometric particles. Using molecular assays, the viruses were identified as pepper yellow mosaic virus (PepYMV) and cucumber mosaic virus (CMV). Aphids, identified as Aphis gossypii, were found colonizing the C. chinense plants in the field and may be the vector for both PepYMV and CMV. We report the first occurrence of these viruses infecting C. chinense in the state of Amazonas.

A pimenta-de-cheiro, Capsicum chinense é uma cultura importante na Bacia Amazônica, cultivada principalmente por pequenos produtores. Plantas de C. chinense em um campo experimental localizado no norte do estado brasileiro do Amazonas, foram encontradas apresentando sintomas característicos de infecção viral. Extratos de amostras de folhas sintomáticas examinados ao microscópio eletrônico de transmissão revelaram a presença de partículas alongadas e flexuosas e de partículas isométricas. Análises moleculares permitiram identificar a presença do pepper yellow mosaic virus (PepYMV) e do cucumber mosaic virus (CMV). Pulgões, identificados como Aphis gossypii foram encontrados colonizando pimenteiras-de-cheiro neste campo experimental e podem representar o provável vetor de PepYMV e CMV. Este trabalho relata a primeira ocorrência desses vírus infectando C. chinense no estado do Amazonas.

Ocurrence of pepper yellow mosaic virus and cucumber mosaic virus on Capsicum chinense in the state of Amazonas, Brazil

The habanero chilli pepper, Capsicum chinense is an important crop in the Amazon Basin, mainly grown by small-scale producers. Capsicum chinense plants in an experimental field in the northern Brazilian state of Amazonas were found exhibiting characteristic symptoms of viral infection. Leaf sap from symptomatic plants examined under a transmission electron microscope revealed the presence of elongated flexuous particles and isometric particles. Using molecular assays, the viruses were identified as pepper yellow mosaic virus (PepYMV) and cucumber mosaic virus (CMV). Aphids, identified as Aphis gossypii, were found colonizing the C. chinense plants in the field and may be the vector for both PepYMV and CMV. We report the first occurrence of these viruses infecting C. chinense in the state of Amazonas. (AU)

Differential Accumulation of Innate- and Adaptive-Immune-Response-Derived Transcripts during Antagonism between Papaya Ringspot Virus and Papaya Mosaic Virus.

Papaya ringspot virus (PRSV), a common potyvirus infecting papaya plants worldwide, can lead to either antagonism or synergism in mixed infections with Papaya mosaic virus (PapMV), a potexvirus. These two unrelated viruses produce antagonism or synergism depending on their order of infection in the plant. When PRSV is inoculated first or at the same time as PapMV, the viral interaction is synergistic. However, an antagonistic response is observed when PapMV is inoculated before PRSV. In the antagonistic condition, PRSV is deterred from the plant and its drastic effects are overcome. Here, we examine differences in gene expression by high-throughput RNA sequencing, focused on immune system pathways. We present the transcriptomic expression of single and mixed inoculations of PRSV and PapMV leading to synergism and antagonism. Upregulation of dominant and hormone-mediated resistance transcripts suggests that the innate immune system participates in synergism. In antagonism, in addition to innate immunity, upregulation of RNA interference-mediated resistance transcripts suggests that adaptive immunity is involved.

Molecular characterization and complete genome of alstroemeria mosaic virus (AlMV).

Even though alstroemeria mosaic virus (AlMV) is one of the most important viruses affecting alstroemeria plants, its genome is only partially available in public sequence databases. High throughput sequencing (HTS) of RNA from alstroemeria plants with symptoms of mosaic and streaking, collected in Lasso-Ecuador, indicated the presence of AlMV and lily symptomless virus. In this study, we aimed to assemble and characterize the complete genome sequence of AlMV. Reads from Illumina sequencing of ribosomal RNA-depleted total RNA were assembled into contigs that were mapped to the sunflower chlorotic mottle virus genome, revealing the 9774 [corrected] bp complete genome sequence of AlMV. Multiple sequence alignment of the AlMV polyprotein with close homologs allowed the identification of ten mature proteins P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb and CP. Furthermore, several potyvirus motifs were identified in the AlMV polyprotein including those related to potyvirus aphid transmission 334KMTC337, 592PTK594 and 2800DAG2802. Phylogenetic analysis based in the polyprotein showed that AlMV belongs to the potato virus Y clade and its closest relative is sunflower ring blotch virus. This study describes the first complete genome of AlMV and its placement within the genus Potyvirus, providing valuable information for future studies on this economically important virus.

Characterization of Cowpea aphid-borne mosaic virus in Passiflora edulis 'Catarina' in the southern coast of Santa Catarina State, Brazil / Caracterização do Cowpea aphid-borne mosaic virus em Passiflora edulis cv. Catarina no litoral sul de Santa Catarina, Brasil

CABMV is a limiting virus for passion fruit crop in Brazil, its main producing country. This virus has been reported in all producing states of the country, with the state of Santa Catarina (SC) in 2017 standing as the third largest passion fruit producer. In 2017, it reached 8.4% of the national production. The southern coast is the main responsible for the increase in production, which has been supplying the domestic market. However, in that same year, this region recorded the first symptom expressions in plants and fruits. The evaluation of the samples collected in the municipalities of Sombrio, Praia Grande and São João do Sul, southern coast of SC, was performed by using a mechanical transmission to indicator plants, PTA-ELISA and RT-PCR, and by sequencing. The evaluation results were positive for CABMV and negative for CMV in PTA-ELISA. In RT-PCR, there was the formation of a 700bp ca band, expected size for Potyvirus, whose sequence comparison with those deposited in GenBank reveled 98% identity with the isolates from São Paulo State. The occurrence of the virus in the southern coast of SC did not reach a serious decrease in passion fruit production due to the union of producers, who adopted preventive management measures to control the virus, whose effect led to a consolidation of the passion fruit production chain in the region.(AU)

O CABMV é um vírus limitante para a cultura do maracujá no Brasil, principal país produtor mundial, cuja ocorrência já foi relatada em todos os estados produtores. Em 2017, o estado de Santa Catarina (SC) foi o terceiro maior produtor de maracujá no Brasil, responsável por 8,4% da produção nacional, sendo o litoral sul o principal responsável pelo aumento da produção, garantindo o abastecimento do mercado interno. Entretanto, nesse mesmo ano, essa região registrou as primeiras expressões de sintomas em plantas e frutos. Uma avaliação das amostras coletadas nos municípios de Sombrio, Praia Grande e São João do Sul, litoral sul de Santa Catarina, foi realizada por transmissão mecânica para plantas indicadoras, PTA-ELISA, RT-PCR e sequenciamento. Os resultados foram positivos para o CABMV e negativos para o CMV, tanto em PTA-ELISA quanto RT-PCR. Na RT-PCR, houve a amplificação de bandas com ca de 700pb, tamanho esperado para o Potyvirus cuja comparação de sequências com as depositadas no GenBank revelaram 98% de similaridade com os isolados do estado de São Paulo. A ocorrência do vírus na região do litoral sul de Santa Catarina não causou quebra na produção de maracujá devido à adoção conjunta de medidas preventivas de manejo pelos produtores, fato que consolidou a cadeia produtiva do maracujá na região.(AU)

Ocurrence of pepper yellow mosaic virus and cucumber mosaic virus on Capsicum chinense in the state of Amazonas, Brazil / Ocorrência do pepper yellow mosaic virus e cucumber mosaic virus em Capsicum chinense no estado do Amazonas, Brasil

The habanero chilli pepper, Capsicum chinense is an important crop in the Amazon Basin, mainly grown by small-scale producers. Capsicum chinense plants in an experimental field in the northern Brazilian state of Amazonas were found exhibiting characteristic symptoms of viral infection. Leaf sap from symptomatic plants examined under a transmission electron microscope revealed the presence of elongated flexuous particles and isometric particles. Using molecular assays, the viruses were identified as pepper yellow mosaic virus (PepYMV) and cucumber mosaic virus (CMV). Aphids, identified as Aphis gossypii, were found colonizing the C. chinense plants in the field and may be the vector for both PepYMV and CMV. We report the first occurrence of these viruses infecting C. chinense in the state of Amazonas.(AU)

A pimenta-de-cheiro, Capsicum chinense é uma cultura importante na Bacia Amazônica, cultivada principalmente por pequenos produtores. Plantas de C. chinense em um campo experimental localizado no norte do estado brasileiro do Amazonas, foram encontradas apresentando sintomas característicos de infecção viral. Extratos de amostras de folhas sintomáticas examinados ao microscópio eletrônico de transmissão revelaram a presença de partículas alongadas e flexuosas e de partículas isométricas. Análises moleculares permitiram identificar a presença do pepper yellow mosaic virus (PepYMV) e do cucumber mosaic virus (CMV). Pulgões, identificados como Aphis gossypii foram encontrados colonizando pimenteiras-de-cheiro neste campo experimental e podem representar o provável vetor de PepYMV e CMV. Este trabalho relata a primeira ocorrência desses vírus infectando C. chinense no estado do Amazonas.(AU)