Comprehensive genomic profiling reveals inactivating SMARCA4 mutations and low tumor mutational burden in small cell carcinoma of the ovary, hypercalcemic-type.

OBJECTIVE: Small cell carcinoma of the ovary, hypercalcemic-type (SCCOHT) is a rare, extremely aggressive neoplasm that usually occurs in young women and is characterized by deleterious germline or somatic SMARCA4 mutations. We performed comprehensive genomic profiling (CGP) to potentially identify additional clinically and pathophysiologically relevant genomic alterations in SCCOHT. METHODS: CGP assessment of all classes of coding alterations in up to 406 genes commonly altered in cancer and intronic regions for up to 31 genes commonly rearranged in cancer was performed on 18 SCCOHT cases (16 exhibiting classic morphology and 2 cases exhibiting exclusive a large cell variant morphology). In addition, a retrospective database search for clinically advanced ovarian tumors with genomic profiles similar to SCCOHT yielded 3 additional cases originally diagnosed as non-SCCOHT. RESULTS: CGP revealed inactivating SMARCA4 alterations and low tumor mutational burden (TMB) (<6mutations/Mb) in 94% (15/16) of SCCOHT with classic morphology. In contrast, both (2/2) cases exhibiting only large cell variant morphology were hypermutated (TMB scores of 90 and 360mut/Mb) and were wildtype for SMARCA4. In our retrospective search, an index ovarian cancer patient harboring inactivating SMARCA4 alterations, initially diagnosed as endometrioid carcinoma, was re-classified as SCCOHT and responded to an SCCOHT chemotherapy regimen. CONCLUSION: The vast majority of SCCOHT demonstrate genomic SMARCA4 loss with only rare co-occurring alterations. Our data support a role for CGP in the diagnosis and management of SCCOHT and of other lesions with overlapping histological and clinical features, since identifying the former by genomic profile suggests benefit from an appropriate regimen and treatment decisions, as illustrated by an index patient.

Clonal History and Genetic Predictors of Transformation Into Small-Cell Carcinomas From Lung Adenocarcinomas.

Purpose Histologic transformation of EGFR mutant lung adenocarcinoma (LADC) into small-cell lung cancer (SCLC) has been described as one of the major resistant mechanisms for epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs). However, the molecular pathogenesis is still unclear. Methods We investigated 21 patients with advanced EGFR-mutant LADCs that were transformed into EGFR TKI-resistant SCLCs. Among them, whole genome sequencing was applied for nine tumors acquired at various time points from four patients to reconstruct their clonal evolutionary history and to detect genetic predictors for small-cell transformation. The findings were validated by immunohistochemistry in 210 lung cancer tissues. Results We identified that EGFR TKI-resistant LADCs and SCLCs share a common clonal origin and undergo branched evolutionary trajectories. The clonal divergence of SCLC ancestors from the LADC cells occurred before the first EGFR TKI treatments, and the complete inactivation of both RB1 and TP53 were observed from the early LADC stages in sequenced tumors. We extended the findings by immunohistochemistry in the early-stage LADC tissues of 75 patients treated with EGFR TKIs; inactivation of both Rb and p53 was strikingly more frequent in the small-cell-transformed group than in the nontransformed group (82% v 3%; odds ratio, 131; 95% CI, 19.9 to 859). Among patients registered in a predefined cohort (n = 65), an EGFR mutant LADC that harbored completely inactivated Rb and p53 had a 43× greater risk of small-cell transformation (relative risk, 42.8; 95% CI, 5.88 to 311). Branch-specific mutational signature analysis revealed that apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC)-induced hypermutation was frequent in the branches toward small-cell transformation. Conclusion EGFR TKI-resistant SCLCs are branched out early from the LADC clones that harbor completely inactivated RB1 and TP53. The evaluation of RB1 and TP53 status in EGFR TKI-treated LADCs is informative in predicting small-cell transformation.

Phase III Randomized, Placebo-Controlled, Double-Blind Trial of Celecoxib in Addition to Standard Chemotherapy for Advanced Non-Small-Cell Lung Cancer With Cyclooxygenase-2 Overexpression: CALGB 30801 (Alliance).

Purpose Tumor overexpression of cyclooxygenase-2 (COX-2) has been associated with worse outcome in non-small-cell lung cancer (NSCLC). In Cancer and Leukemia Group B (CALGB) 30203, we found that the selective COX-2 inhibitor celecoxib in addition to chemotherapy in advanced NSCLC improved progression-free and overall survival in patients with moderate to high COX-2 expression by immunohistochemistry (IHC). CALGB 30801 (Alliance) was designed to prospectively confirm that finding. Patients and Methods Patients with NSCLC (stage IIIB with pleural effusion or stage IV according to American Joint Committee on Cancer [sixth edition] criteria) were preregistered, and biopsy specimens were analyzed for COX-2 by IHC. Patients with COX-2 expression ≥ 2, performance status of 0 to 2, and normal organ function were eligible. Chemotherapy was determined by histology: carboplatin plus pemetrexed for nonsquamous NSCLC and carboplatin plus gemcitabine for squamous histology. Patients were randomly assigned to celecoxib (400 mg twice per day; arm A) or placebo (arm B). The primary objective was to demonstrate improvement in progression-free survival in patients with COX-2 index ≥ 4 with hazard ratio of 0.645 with approximately 85% power at two-sided significance level of .05. Results The study was halted for futility after 312 of the planned 322 patients with COX-2 index ≥ 2 were randomly assigned. There were no significant differences between the groups (hazard ratio, 1.046 for COX-2 ≥ 4). Subset analyses evaluating histology, chemotherapy regimen, and incremental COX-2 expression did not demonstrate any advantage for COX-2 inhibition. Elevation of baseline urinary metabolite of prostaglandin E2, indicating activation of the COX-2 pathway, was a negative prognostic factor. Values above the third quartile may have been a predictive factor. Conclusion COX-2 expression by IHC failed to select patients who could benefit from selective COX-2 inhibition. Urinary metabolite of prostaglandin E2 may be able to identify patients who could benefit from COX-2 inhibition.

The histone methyltransferase EZH2 is a therapeutic target in small cell carcinoma of the ovary, hypercalcaemic type.

Small cell carcinoma of the ovary, hypercalcaemic type (SCCOHT) is a rare but aggressive and untreatable malignancy affecting young women. We and others recently discovered that SMARCA4, a gene encoding the ATPase of the SWI/SNF chromatin-remodelling complex, is the only gene recurrently mutated in the majority of SCCOHT. The low somatic complexity of SCCOHT genomes and the prominent role of the SWI/SNF chromatin-remodelling complex in transcriptional control of genes suggest that SCCOHT cells may rely on epigenetic rewiring for oncogenic transformation. Herein, we report that approximately 80% (19/24) of SCCOHT tumour samples have strong expression of the histone methyltransferase EZH2 by immunohistochemistry, with the rest expressing variable amounts of EZH2. Re-expression of SMARCA4 suppressed the expression of EZH2 in SCCOHT cells. In comparison to other ovarian cell lines, SCCOHT cells displayed hypersensitivity to EZH2 shRNAs and two selective EZH2 inhibitors, GSK126 and EPZ-6438. EZH2 inhibitors induced cell cycle arrest, apoptosis, and cell differentiation in SCCOHT cells, along with the induction of genes involved in cell cycle regulation, apoptosis, and neuron-like differentiation. EZH2 inhibitors suppressed tumour growth and improved the survival of mice bearing SCCOHT xenografts. Therefore, our data suggest that loss of SMARCA4 creates a dependency on the catalytic activity of EZH2 in SCCOHT cells and that pharmacological inhibition of EZH2 is a promising therapeutic strategy for treating this disease. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Loss of SMARCA4 Expression Is Both Sensitive and Specific for the Diagnosis of Small Cell Carcinoma of Ovary, Hypercalcemic Type.

Small cell carcinoma of the ovary, hypercalcemic type (SCCOHT) is a rare ovarian neoplasm that occurs in young women and has a poor prognosis. The histologic diagnosis of SCCOHT can be challenging due to its rarity and relatively nonspecific histologic features, which range from the classic, first-described small cell morphology to a pattern in which there are large cells with abundant eosinophilic cytoplasm. Many entities can be in the differential diagnosis and to date, immunohistochemical stains have shown no distinctive profile and have been of limited aid. SMARCA4 (also known as BRG1) mutations have recently been reported at high frequency in these tumors. SMARCA4 is an important component of the SWI/SNF complex that regulates gene expression through alteration of nucleosome conformation. Studies to date have suggested that immunohistochemical loss of expression of SMARCA4 is associated with the presence of a SMARCA4 mutation in most cases. In this study, the sensitivity and specificity of the immunohistochemical loss of SMARCA4 expression for the diagnosis of SCCOHT is examined in the context of the differential diagnosis with other primary or metastatic ovarian tumors. All but one of the SCCOHT showed loss of SMARCA4 expression (16/17; 94%), while of 279 other tumors tested, only two tumors (one clear cell carcinoma and one ovarian melanoma) showed loss of SMARCA4 expression. We conclude that SMARCA4 immunohistochemistry is highly sensitive and specific for a diagnosis of SCCOHT and is of clinical utility in the differential diagnosis of poorly differentiated ovarian tumors.

Novel anticancer agent, SQAP, binds to focal adhesion kinase and modulates its activity.

SQAP is a novel and promising anticancer agent that was obtained by structural modifications from a natural compound. SQAP inhibits angiogenesis in vivo resulting in increased hypoxia and reduced tumor volume. In this study, the mechanism by which SQAP modifies the tumor microenvironment was revealed through the application of a T7 phage display screening. This approach identified five SQAP-binding proteins including sterol carrier protein 2, multifunctional enzyme type 2, proteasomal ubiquitin receptor, UV excision repair protein and focal adhesion kinase (FAK). All the interactions were confirmed by surface plasmon resonance analysis. Since FAK plays an important role in cell turnover and angiogenesis, the influence of SQAP on FAK was the principal goal of this study. SQAP decreased FAK phosphorylation and cell migration in human umbilical vein endothelial cells and A549 cancer cells. These findings suggest that inhibition of FAK phosphorylation works as the mechanism for the anti-angiogenesis activity of SQAP.

KAT6B Is a Tumor Suppressor Histone H3 Lysine 23 Acetyltransferase Undergoing Genomic Loss in Small Cell Lung Cancer.

Recent efforts to sequence human cancer genomes have highlighted that point mutations in genes involved in the epigenetic setting occur in tumor cells. Small cell lung cancer (SCLC) is an aggressive tumor with poor prognosis, where little is known about the genetic events related to its development. Herein, we have identified the presence of homozygous deletions of the candidate histone acetyltransferase KAT6B, and the loss of the corresponding transcript, in SCLC cell lines and primary tumors. Furthermore, we show, in vitro and in vivo, that the depletion of KAT6B expression enhances cancer growth, while its restoration induces tumor suppressor-like features. Most importantly, we demonstrate that KAT6B exerts its tumor-inhibitory role through a newly defined type of histone H3 Lys23 acetyltransferase activity.

Acquisition of new tumor cell properties by MSC-derived exosomes.

Interaction between multi-functional mesenchymal stroma/stem cells (MSC) and human tumor cells involves the exchange of biological material via extracellular vesicles including exosomes. Protein analysis of MSC-derived exosomes demonstrated the presence of MMP-2 and MSC-specific markers including CD90 and ecto-5'-nucleotidase (CD73). Incubation of tumor cells with these membranous particles revealed a rapid uptake of MSC-released microvesicles whereby breast cancer cells incorporated ~19% and SCCOHT-1 cells representing a rare type of small cell ovarian cancer assimilated ~28% of available exosomes within 24 h. This interaction was accompanied by functional alterations of tumor cell properties during integration of exosomal content from MSC. Indeed, exosome-associated MMP-2 exhibited functional enzyme activity and MCF-7 breast cancer cells with undetectable MMP-2 protein acquired expression of this enzyme and corresponding gelatinase functionality after stimulation with MSC-derived exosomes. Similar effects were observed in SCCOHT-1 cells during culture in the presence of MSC-derived exosomes which enabled new metabolic activities in this tumor cell type. Together, these findings demonstrated that the internalization of MSC-derived exosomes was associated with the acquisition of new tumor cell properties by altering cellular functionalities and providing the capability to re-organize the tumor microenvironment.

Anaplastic lymphoma kinase gene expression in small round cell tumors of childhood--a comparative immunohistochemical study.

The focus of this study was to investigate anaplastic lymphoma kinase (ALK) expression by immunohistochemistry using a highly specific antibody. Distribution and frequency of ALK expression may provide a clue for ALK inhibitor use in small round cell tumors of childhood. The study group involved 76 small round cell tumors of childhood, which composed of 11 rhabdomyosarcomas, 13 Wilms tumors, 7 Ewing sarcoma/primitive neuroectodermal tumors, 34 peripheral neuroblastic tumors, and 11 acute lymphoblastic lymphoma. Anaplastic lymphoma kinase protein expression in small round cell tumors of childhood is poorly described in the literature. The findings of our study highlight a potential and possible role of targeting ALK in pediatric solid tumors by using ALK immunohistochemistry. Anaplastic lymphoma kinase may also have an oncogenic role in rhabdomyosarcomas and peripheral neuroblastic tumors, and they may possibly be treated with ALK inhibitors. Anaplastic lymphoma kinase expression in Wilms tumors is not reported in the literature, previously. Our study evaluated ALK expression in Wilms tumor samples.

Impact of ERCC1 expression on treatment outcome in small-cell lung cancer patients treated with platinum-based chemotherapy.

INTRODUCTION: The excision repair cross-complementing 1 (ERCC1) protein is an extensively investigated molecular marker because it may decrease sensitivity to platinum-based chemotherapy. Low ERCC1 expression has already been correlated with better treatment efficacy in non-small-cell lung cancer patients treated with platinum-based chemotherapy. However, the data on a prognostic and/or predictive value of ERCC1 in small-cell lung cancer (SCLC) are still very limited. METHODS: This retrospective pilot study evaluated the impact of ERCC1 expression levels on response to first-line platinum-based chemotherapy with or without radiotherapy and survival outcomes of 77 SCLC patients. ERCC1 protein expression was determined immunohistochemically in primary tumour tissue. RESULTS: ERCC1 protein expression was positive in 40/77 (51.9%) of our patients. No significant association was found between ERCC1 protein expression and response rate to first-line platinum-based chemotherapy, progression-free survival (PFS), or overall survival (OS), either in the overall population or in patients stratified by disease stage. CONCLUSIONS: In our limited group of 77 SCLC patients, ERCC1 protein expression was not found to correlate with either response rate to platinum-based chemotherapy or survival outcomes. Multi-centric prospective trials using a validated method of ERCC1 determination are mandatory in order to obtain a definitive answer on the predictive value of ERCC1 in SCLC.

An immunohistochemical and molecular genetic analysis of KIT and PDGFRA in small cell lung carcinoma in Japanese.

KIT and PDGFRA in small cell lung carcinoma (SCLC) have been rarely examined in Japanese. The author investigated protein expression of KIT and PDGFRA in 54 Japanese cases of small cell lung carcinoma by immunohistochemistry, and gene mutations of KIT and PDGFRA in 20 Japanese cases of small cell lung carcinoma by the PCR-direct sequencing method. The molecular genetic analysis showed no mutations of KIT (exons 9, 11, 13, and 17) and PDGFRA (exons 12 and 18) genes in all 20 cases. KIT protein expression was recognized in all cases (100%). Membranous KIT expression was strong in 35 cases, moderate in 7 cases and weak in 12 cases. PDGFRA protein expression was noted in 35 cases (65%); the membranous expression was strong in 2 cases, moderate in 16 cases, and weak in 17 cases. The overall median survival was 13 months. There was no significant difference in the survival between KIT strongly positive cases (median, 12 months) and KIT moderately or weakly positive cases (median, 11 months). Likewise, there was no significant difference in the survival between PDGFRA-positive cases (median, 11 months) and PDGFRA-negative cases (median, 12 months). The protein expressions of KIT and PDGFRA did not correlate with gender, smoking, and disease stage. These findings suggest, in Japanese population, that mutations of KIT and PDGFRA were absent in small cell lung carcinoma of Japan, that KIT protein expression is present in 100%, that PDGFRA expression is present in 65%, and that KIT and PDGFRA protein expressions do not correlate with survival, gender, smoking, and disease stage.

A tumor-derived population (SCCOHT-1) as cellular model for a small cell ovarian carcinoma of the hypercalcemic type.

The small cell ovarian carcinoma of the hypercalcemic type (SCCOHT) represents an aggressive tumor with poor prognosis predominantly affecting young women and so far, no cell line or animal model is available to investigate this devastating disease. Biopsy material from a recurrent SCCOHT was subjected to an explant culture to obtain an adherent and continuously proliferating cell population. Morphological and functional characterization revealed a heterogeneous population (SCCOHT-1) of about 13 µm in diameter and approximately 36 h of doubling time. Flow cytometric analysis of surface markers demonstrated the expression of CD15, CD29, CD44 and CD90 paralleled by the presence of cytokeratins and vimentin. Cytogenetic analysis and high-resolution oligo-array comparative genomic hybridization (aCGH) demonstrated a stable karyotype including deletions of the PARK2, CSMD1, GRIN2B and ATF7IP genes. Following lentiviral transduction with a GFP vector, the labeled SCCOHT-derived cells were subjected to CCE to separate distinct subpopulations as evidenced by cell cycle analysis. Subcutaneous injection of these subpopulations into NOD/SCID mice exhibited hypercalcemia and a tumor development in 100% of the mice. Re-cultivation of the mouse tumors revealed an outgrowth of SCCOHT-derived phenotypes and all cell populations expressed high telomerase activity. Moreover, histopathological evaluation demonstrated close similarities between the mouse tumors and the original patient tumor. In conclusion, SCCOHT-1 cells provide a study platform to investigate this rare disease and to examine effective and sufficient therapeutic strategies for this rather unknown type of cancer.

CAXII Is a sero-diagnostic marker for lung cancer.

To develop sero-diagnostic markers for lung cancer, we generated monoclonal antibodies using pulmonary adenocarcinoma (AD)-derived A549 cells as antigens by employing the random immunization method. Hybridoma supernatants were immunohistochemically screened for antibodies with AMeX-fixed and paraffin-embedded A549 cell preparations. Positive clones were monocloned twice through limiting dilutions. From the obtained monoclonal antibodies, we selected an antibody designated as KU-Lu-5 which showed intense membrane staining of A549 cells. Based on immunoprecipitation and MADLI TOF/TOF-MS analysis, this antibody was recognized as carbonic anhydrase XII (CAXII). To evaluate the utility of this antibody as a sero-diagnostic marker for lung cancer, we performed dot blot analysis with a training set consisting of sera from 70 lung cancer patients and 30 healthy controls. The CAXII expression levels were significantly higher in lung cancer patients than in healthy controls in the training set (P<0.0001), and the area under the curve of ROC was 0.794, with 70.0% specificity and 82.9% sensitivity. In lung cancers, expression levels of CAXII were significantly higher in patients with squamous cell carcinoma (SCC) than with AD (P = 0.035). Furthermore, CAXII was significantly higher in well- and moderately differentiated SCCs than in poorly differentiated ones (P = 0.027). To further confirm the utility of serum CAXII levels as a sero-diagnostic marker, an additional set consisting of sera from 26 lung cancer patients and 30 healthy controls was also investigated by dot blot analysis as a validation study. Serum CAXII levels were also significantly higher in lung cancer patients than in healthy controls in the validation set (P = 0.030). Thus, the serum CAXII levels should be applicable markers discriminating lung cancer patients from healthy controls. To our knowledge, this is the first report providing evidence that CAXII may be a novel sero-diagnostic marker for lung cancer.

Immunohistochemical analysis of the ubiquitin-conjugating enzyme UbcH10 in lung cancer: a useful tool for diagnosis and therapy.

The ubiquitin-conjugating enzyme (UbcH10) plays important roles in the regulation of cell cycle progression. Recently, UbcH10 expression has been demonstrated in several human and experimental tumors, and proteasome inhibitors have been tested in trials for pulmonary neoplasms; however, the underlying mechanisms as well as the clinicopathological relevance of UbcH10 in the genesis and progression of lung cancer remain largely unknown. Therefore, the authors evaluated the expression of UbcH10 in human lung cancer and evaluated its possible diagnostic and prognostic use. They found that most cases of lung adenocarcinoma, squamous cell carcinoma, and large cell and small cell carcinoma were positive for UbcH10. The expression levels of UbcH10 progressively increased with decreasing degree of tumor differentiation. There was a statistically significant difference of UbcH10 positivity between grade I/III of lung adenocarcinoma (p=0.013) and squamous cell carcinoma (p=0.002). No significant differences were found between histological types (p=0.072). In the case of cell blocks prepared from pleural effusions, inflammatory and reactive mesothelial elements did not show appreciable UbcH10 expression, whereas neoplastic cells exhibited clear UbcH10 positivity. The results suggest that UbcH10 might represent a new and promising diagnostic and prognostic marker in both histologic and cytologic specimens of lung cancer.

Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer.

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67 fmol/µg DNA/h vs 3.47±1.35 fmol/µg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

Treatment with the Chk1 inhibitor Gö6976 enhances cisplatin cytotoxicity in SCLC cells.

Acquired chemoresistance is a major obstacle in successful treatment of small cell lung cancer (SCLC). DNA damage responses can potentially contribute to resistance by halting the cell cycle following exposure to therapeutic agents, thereby facilitating repair of drug-induced lesions and protecting tumour cells from death. The Chk1 protein kinase is a key regulator in this response. We analysed the status of cell cycle checkpoint proteins and the effects of the Chk1 inhibitor Gö6976 on cisplatin toxicity in SCLC cell lines. IC50s for cisplatin were determined using the MTT assay in six SCLC cell lines. Effects on cell cycle distribution and apoptosis were determined by flow cytometry and caspase 3 activation in the presence or absence of the Chk1 inhibitor Gö6976. The activation of checkpoint proteins was determined by Western blotting. Cell lines were divided into chemosensitive and chemoresistant groups on the basis of our results. While checkpoint responses were detected in these cell lines through Western blotting, some of these responses were delayed or weaker than those seen in other cell types in response to DNA damage and replication stress. Gö6976 significantly (p<0.05) enhanced the levels of apoptosis seen in response to a clinically relevant dose of cisplatin (<6 µM) and decreased drug-induced G2 arrest in chemosensitive cells. Our data suggest a role for Chk1 in chemoresistance of SCLC cells and a potential approach to improve initial response of SCLC to cisplatin therapy.

Carbonic anhydrase IX is expressed in mesothelioma and metastatic clear cell renal cell carcinoma of the lung.

High immunohistochemical expression of carbonic anhydrase IX (CAIX) is found in clear cell renal cell carcinoma (ccRCC), but no studies have assessed CAIX in metastatic ccRCC (mccRCC) of the lung. As 75% of patients with mccRCC show lung involvement, characterization of protein expression in these lesions is warranted. This investigation analyzed CAIX immunohistochemical expression in pulmonary/pleural tumors including mccRCC (n = 22), mesothelioma (n = 19), squamous cell carcinoma (n = 27), small cell carcinoma (n = 9), and adenocarcinoma (n = 49), as well as other mesothelial lesions (n = 4). Membranous immunoreactivity was semiquantitatively evaluated for percent of cells stained and intensity. All cases of mccRCC (1+, 4.5%; 3+, 95.5%) and mesothelioma (2+, 10.5%; 3+, 89.5%) expressed CAIX. Most cases of lung squamous cell carcinoma (0, 11.1%; 1+, 25.9%; 2+, 22.2%; 3+, 40.7%) and small cell carcinoma were reactive (0, 11.1%; 1+, 22.2%; 2+, 33.3%; 3+, 33.3%), while CAIX was detected less frequently in pulmonary adenocarcinoma (0, 61.2%; 1+, 16.3%; 2+, 12.2%; 3+, 10.2%). In addition, CAIX was positive in adenomatoid tumor (3+, 100%) and mesothelial hyperplasia (3+, 100%). We demonstrate that CAIX is sensitive for mccRCC within the lung and a novel immunohistochemical marker for mesothelial proliferations, notably mesothelioma. Variable immunoreactivity is present among primary pulmonary epithelial tumors. Knowledge of expression overlap between these entities may prevent an incorrect interpretation of immunohistochemical results, particularly when limited tissue is available. As new carbonic anhydrase inhibitors are being evaluated, testing additional tumors for CAIX may lead to novel treatment options.

[A brief overview of a lung cancer biomarker: thymidylate synthase]. / Un regard simple sur la biologie moléculaire du cancer bronchique : la thymidylate synthase (TS).

Thymidylate synthase (TS) is an enzyme, which catalyzes the methylation of deoxyuridylate to deoxythymidylate using 5.10-methylenetetrahydrofolate as a cofactor. For this reason, TS has been widely investigated and is one of the best-known drug targets in the anticancer area. Antimetabolites have been developed to target TS and among them, pemetrexed is now considered as part of the standard treatment for lung cancer and mesothelioma. Intratumoral expression of TS mRNA has been shown to be associated with prognosis and with the response to 5-FU therapy in patients with breast, colorectal, head and neck cancer types. Recent findings suggest that TS might be a biomarker for NSCLC treated with pemetrexed, as lower response rates in squamous cell carcinoma and small cell carcinoma may be due to a higher expression of TS. Specific validation for this use as a biomarker is awaited. All these recent findings suggest that TS could be a useful predictive marker of the treatment efficacy of antifolate drugs and indicate that both Real-Time PCR and immuno-histochemistry might be used to assess TS expression levels. This may help in defining the best therapeutic strategy.

Folate hydrolase (prostate-specific membrane [corrected] antigen) 1 expression in bladder cancer subtypes and associated tumor neovasculature.

Folate hydrolase (prostate-specific antigen) 1 (FH(PSA)1), also known as prostate-specific membrane antigen (PSMA), is a transmembrane receptor expressed on prostate cancer cells that correlates with a more aggressive phenotype. Recent studies have demonstrated FH(PSA)1 expression in numerous benign and malignant tissue types, as well as the malignant neovasculature. As FH(PSA)1 represents a diagnostic immunomarker for prostate cancer, we explored its expression pattern in various subtypes of bladder cancer. Immunohistochemical analysis (IHC) of FH(PSA)1 was performed using tissue microarrays constructed from 167 bladder cancers, including 96 urothelial carcinomas (UCCs), 37 squamous cell carcinomas, 17 adenocarcinomas and 17 small cell carcinomas. We used a FH(PSA)1 monoclonal antibody obtained from Dako (clone 3E6, dilution 1:100), which recognizes the epitope present in the 57-134 amino acid region of the extracellular portion of the PSMA molecule. Intensity of IHC staining was scored as 0 (no expression) to 3+ (strong expression), with 2-3+ IHC considered a positive result. FH(PSA)1 demonstrated expression in a subset of bladder cancers and was most common in small cell carcinoma (3/17; 18%), with concurrent expression in non-small cell components in a subset of cases (2/6). FH(PSA)1 expression was less frequent in UCC (3/96; 3%) and adenocarcinoma (2/17; 12%). None of the squamous cell carcinomas demonstrated tumor cell expression of FH(PSA)1. However, all bladder cancers examined expressed FH(PSA)1 in the tumor vasculature, suggesting a potential role for this molecule in mediating new vessel ingrowth. FH(PSA)1 may occasionally be expressed in various subtypes of bladder cancer. These findings suggest cautious use of FH(PSA)1 as a diagnostic marker for prostatic tissue invading the bladder. The finding of FH(PSA)1 in the bladder cancer neovasculature suggests that this molecule may promote tumor growth and may represent a potential new vascular target in this disease.