RESUMO
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Assuntos
Transfusão de Sangue , DNA Viral/sangue , Herpesvirus Humano 6/genética , Herpesvirus Humano 7/genética , Herpesvirus Humano 8/genética , Reação em Cadeia da Polimerase Multiplex/métodos , DNA Viral/genética , Feminino , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Reação em Cadeia da Polimerase Multiplex/normas , Estudos Prospectivos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/métodos , Carga Viral/normasAssuntos
Transtornos da Cefaleia , Herpesvirus Humano 7/patogenicidade , Linfocitose , Infecções por Roseolovirus , Adulto , Eletroencefalografia , Transtornos da Cefaleia/líquido cefalorraquidiano , Transtornos da Cefaleia/diagnóstico , Transtornos da Cefaleia/etiologia , Transtornos da Cefaleia/fisiopatologia , Herpesvirus Humano 7/isolamento & purificação , Humanos , Linfocitose/líquido cefalorraquidiano , Linfocitose/diagnóstico , Linfocitose/etiologia , Imageamento por Ressonância Magnética , Masculino , Infecções por Roseolovirus/líquido cefalorraquidiano , Infecções por Roseolovirus/complicações , Infecções por Roseolovirus/diagnósticoRESUMO
During local small measles outbreak in Japan, 3 adolescents with febrile skin rash suspected as having measles were diagnosed with primary human herpesvirus (HHV)-7 infection. Primary HHV-7 infection can cause exanthem subitum in not only young children but also adolescents. HHV-7 should be considered as a possible causative agent for adolescent febrile skin rash during the measles outbreak.
Assuntos
Anticorpos Antivirais/sangue , Surtos de Doenças/estatística & dados numéricos , Exantema Súbito/diagnóstico , Sarampo/epidemiologia , Infecções por Roseolovirus/diagnóstico , Adolescente , Exantema Súbito/virologia , Feminino , Febre/virologia , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 7/patogenicidade , Humanos , Japão/epidemiologia , MasculinoRESUMO
BACKGROUND: The objective was to assess the oral shedding and viremia of human herpesviruses in renal transplant recipients. METHODS: This is a cohort study in which the participants were examined in three different periods: the first within 24 hours before renal transplantation and the second and third ones 15-20 and 45-60 days after the transplantation. Mouthwash and blood samples were collected in each period and then submitted to screening for the presence of eight types of human herpesviruses by using multiplex PCR. RESULTS: HSV-1 and EBV were more frequent in the saliva after renal transplantation, 15- to 20-day period after the transplant. EBV was found in the saliva of 26 (35.6%) patients before renal transplantation and in 56.2% and 46.6% of them, in the 15- to 20-day and 45- to 60-day periods after the transplant, respectively. High detection rates (75.3%-78.1%) were found for HHV-7 despite the lack of significant variations between the study periods. There was no concordance between herpesviruses oral shedding and viremia. CONCLUSION: We concluded that the pattern of excretion of HSV-1 and EBV in saliva is changed immediately after renal transplantation, increasing in the 15- to 20-day period after the transplant surgery. No concordance between herpesviruses oral shedding and viremia was observed.
Assuntos
Infecções por Herpesviridae/diagnóstico , Transplante de Rim/efeitos adversos , Boca/virologia , Transplantados/estatística & dados numéricos , Viremia , Eliminação de Partículas Virais , Adulto , Estudos de Coortes , Citomegalovirus/isolamento & purificação , Infecções por Citomegalovirus/diagnóstico , Infecções por Citomegalovirus/virologia , Feminino , Herpesviridae/isolamento & purificação , Herpesvirus Humano 1/isolamento & purificação , Herpesvirus Humano 4/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Humanos , Estudos Longitudinais , Masculino , Pessoa de Meia-Idade , Saliva/virologia , Carga ViralAssuntos
Síndrome de Hipersensibilidade a Medicamentos/complicações , Infecções por Herpesviridae/epidemiologia , Ativação Viral/imunologia , Citomegalovirus/genética , Citomegalovirus/imunologia , Citomegalovirus/isolamento & purificação , DNA Viral/isolamento & purificação , Síndrome de Hipersensibilidade a Medicamentos/sangue , Síndrome de Hipersensibilidade a Medicamentos/imunologia , Feminino , Infecções por Herpesviridae/sangue , Infecções por Herpesviridae/imunologia , Infecções por Herpesviridae/virologia , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/imunologia , Herpesvirus Humano 4/isolamento & purificação , Herpesvirus Humano 6/genética , Herpesvirus Humano 6/imunologia , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/imunologia , Herpesvirus Humano 7/isolamento & purificação , Hospitalização/estatística & dados numéricos , Hospitais Universitários/estatística & dados numéricos , Humanos , Masculino , Pessoa de Meia-Idade , Ohio/epidemiologia , Reação em Cadeia da Polimerase , Estudos Retrospectivos , Centros de Atenção Terciária/estatística & dados numéricosRESUMO
These updated guidelines from the Infectious Diseases Community of Practice of the American Society of Transplantation review the diagnosis, prevention, and management of HHV-6A, HHV-6B, HHV-7, and HHV-8 in the pre- and post-transplant period. The majority of HHV-6 (A and B) and HHV-7 infections in transplant recipients are asymptomatic; symptomatic disease is reported infrequently across organs. Routine screening for HHV-6 and 7 DNAemia is not recommended in asymptomatic patients, nor is prophylaxis or preemptive therapy. Detection of viral nucleic acid by quantitative PCR in blood or CSF is the preferred method for diagnosis of HHV-6 and HHV-7 infection. The possibility of chromosomally integrated HHV-6 DNA should be considered in individuals with persistently high viral loads. Antiviral therapy should be initiated for HHV-6 encephalitis and should be considered for other manifestations of disease. HHV-8 causes Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman disease and is also associated with hemophagocytic syndrome and bone marrow failure. HHV-8 screening and monitoring may be indicated to prevent disease. Treatment of HHV-8 related disease centers on reduction of immunosuppression and conversion to sirolimus, while chemotherapy may be needed for unresponsive disease. The role of antiviral therapy for HHV-8 infection has not yet been defined.
Assuntos
Antivirais/uso terapêutico , Infecções por Herpesviridae/diagnóstico , Infecções por Herpesviridae/tratamento farmacológico , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Transplante de Órgãos/efeitos adversos , Guias de Prática Clínica como Assunto/normas , Infecções por Herpesviridae/etiologia , Humanos , Sociedades Médicas , TransplantadosAssuntos
Doença de Alzheimer/etiologia , Infecções por Roseolovirus/complicações , Doença de Alzheimer/virologia , Encéfalo/patologia , Encéfalo/virologia , Genes Virais , Variação Genética , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Interações Hospedeiro-Patógeno , Humanos , Infecções por Roseolovirus/patologiaRESUMO
Tanto la pitiriasis liquenoide y varioliforme aguda como la pitiriasis liquenoide crónica representan 2 extremos de un espectro de enfermedad de etiología desconocida. En este trabajo se describen 2 casos de pitiriasis liquenoide y varioliforme aguda, en los que se detectó ADN de virus herpes humano tipo 7 en muestras de piel mediante la metodología de reacción en cadena de la polimerasa, una asociación no descrita previamente. Este manuscrito puede apoyar la participación de la infección viral en la etiopatogenia de esta enfermedad
Pityriasis lichenoides et varioliformis acuta and pityriasis lichenoides chronica represent 2 ends of a disease spectrum of unknown etiology. Herein we describe 2 cases of pityriasis lichenoides et varioliformis acuta, in which human herpesvirus 7 DNA was detected in skin samples by polymerase chain reaction methodology, an association not previously described. This report may support the involvement of viral infection in the etiopathogeny of this disease
Assuntos
Humanos , Masculino , Feminino , Adulto , Infecções por Herpesviridae/virologia , Herpesvirus Humano 7/isolamento & purificação , Pitiríase Liquenoide/virologia , DNA Viral/análise , Diagnóstico Diferencial , Infecções por Herpesviridae/diagnóstico , Herpesvirus Humano 7/genética , Herpesvirus Humano 7/patogenicidade , Pitiríase Liquenoide/patologia , Reação em Cadeia da Polimerase Via Transcriptase ReversaRESUMO
BACKGROUND: Pityriasis rosea (PR) is a self-limiting exanthematous disease associated with human herpesvirus (HHV)-6 and/or HHV-7 reactivation. In pregnant women, PR may be associated with pregnancy complications. OBJECTIVE: To determine relevant risk factors in the development of negative pregnancy outcome in PR. METHODS: Between 2005 and 2017 at the Department of Dermatology, University of Genoa, we recruited 76 women who developed PR during pregnancy. In 60 patients without known risk factors for intrauterine fetal death (30 with pregnancy complications and 30 without) we analyzed the pregnancy week of PR onset, presence of enanthem and of constitutional symptoms, PR body surface area involvement, age, and in 50 patients (20 with pregnancy complications and 30 without), the viral load of HHV-6 and HHV-7 (copies/mL). RESULTS: In logistic regression analysis, early onset of PR (p = 0.0017) and enanthem (p = 0.0392) proved to be significantly associated with pregnancy complications. HHV-6 viral load (copies/mL) (p < 0.0001), constitutional symptoms (p < 0.001), and PR body surface area involvement (p < 0.004) were also significantly associated with pregnancy complications. CONCLUSION: The onset of PR before week 15 and enanthem may be considered major risk factors that should alarm the dermatologist. Constitutional symptoms and involvement of > 50% of the body area may be considered minor risk factors.
Assuntos
DNA Viral/sangue , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Doenças da Boca/epidemiologia , Pitiríase Rósea/epidemiologia , Complicações na Gravidez/epidemiologia , Aborto Espontâneo/sangue , Aborto Espontâneo/epidemiologia , Adulto , Índice de Apgar , Feminino , Forame Oval Patente/sangue , Forame Oval Patente/epidemiologia , Idade Gestacional , Humanos , Recém-Nascido de Baixo Peso , Recém-Nascido , Doenças da Boca/virologia , Mucosa Bucal , Hipotonia Muscular/sangue , Hipotonia Muscular/epidemiologia , Pitiríase Rósea/sangue , Pitiríase Rósea/virologia , Poli-Hidrâmnios/sangue , Poli-Hidrâmnios/epidemiologia , Gravidez , Complicações na Gravidez/sangue , Complicações na Gravidez/virologia , Fatores de Risco , Carga ViralRESUMO
Neurological manifestations associated with HHV-7 have been described in primary infection in children, and very occasionally in immunocompromised adult patients. However, the role of HHV-7 reactivation as a cause of central nervous system (CNS) diseases in immunocompetent adults has not yet been defined. We retrospectively analyzed clinical and microbiological features of adults with neurological symptoms who underwent lumbar puncture and a multiplex polymerase chain reaction (PCR) for herpesviruses (HHV-1-8) and enteroviruses performed in cerebrospinal fluid (CSF), during a 4-year period. A total of 251 subjects were included. Mean age was 55 years, ranging 15-89. Globally, HHV-7 DNA was detected in CSF in 14 patients (5.6%). It was detected in 1 of 36 patients with microbiologically confirmed CNS infections, and in 7 of 172 patients with diagnoses of non-infectious neurological disorders (Specificity 0.96, 95% confidence interval 0.93-0.99). Additionally, HHV-7 DNA was detected in 6 of 21 patients (28.6%) with probable CNS infections (compatible clinical syndrome and CSF changes) in the absence of other causative agent: four meningitis, one myelitis, and one encephalitis. Treatment with foscarnet was effective in achieving improvement of symptoms and clearance of HHV-7 DNA in CSF in the cases of encephalitis and myelitis, while ganciclovir was ineffective in the case of encephalitis. Our results show that HHV-7 reactivation may cause CNS disease in immunocompetent adults and that detection of HHV-7 DNA in CSF as a false-positive result or as asymptomatic reactivation in adult patients with neurological diseases is uncommon. Foscarnet seems the first-line treatment for HHV-7 CNS disease.
Assuntos
DNA Viral/genética , Encefalite Viral/diagnóstico , Herpesvirus Humano 7/genética , Meningite Viral/diagnóstico , Mielite/diagnóstico , Infecções por Roseolovirus/diagnóstico , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Antivirais/uso terapêutico , DNA Viral/líquido cefalorraquidiano , DNA Viral/isolamento & purificação , Encefalite Viral/líquido cefalorraquidiano , Encefalite Viral/tratamento farmacológico , Encefalite Viral/virologia , Feminino , Foscarnet/uso terapêutico , Ganciclovir/uso terapêutico , Herpesvirus Humano 7/isolamento & purificação , Humanos , Masculino , Meningite Viral/líquido cefalorraquidiano , Meningite Viral/tratamento farmacológico , Meningite Viral/virologia , Pessoa de Meia-Idade , Mielite/líquido cefalorraquidiano , Mielite/tratamento farmacológico , Mielite/virologia , Estudos Retrospectivos , Infecções por Roseolovirus/líquido cefalorraquidiano , Infecções por Roseolovirus/tratamento farmacológico , Infecções por Roseolovirus/virologia , Punção Espinal/métodosRESUMO
OBJECTIVE: Introduction: In this study, we investigated the possible involvement of Human herpesvirus 7 in multiple sclerosis. The aim: To contribute to clarifying the controversy on the association between Human Herpesviruses 7 (HHV-7) and multiple sclerosis (MS) studying patient with relapsing-remitting MS (RRMS). PATIENTS AND METHODS: Case study: Young female admitted to adult tertiary referral, infectious diseases hospital, Kyiv, Ukraine, with signs of a focal neurological deficit. Meningeal symptoms were not detected. The preadmission illness lasted some years. Clinical diagnosis was relapsing-remitting multiple sclerosis (RRMS). On admission, general condition was of moderate severity. She has a mild fever, confusion, speech and coordination disorders, dizziness, worsening of memory, inability to walk (inferior paraparesis). Focal lesions were detected on MRI scan. The spinal fluid contained oligoclonal IgG-chains and HHV-7 DNA. After two weeks of intensive antiviral treatment, the patient's condition improved significantly,the function of the lower limbs recovered almost completely, and she was discharged home. CONCLUSION: Conclusion: Here we present a comprehensive clinical, radiological and virological analysis of the HHV-7-associated case of multiple sclerosis.
Assuntos
Herpesvirus Humano 7/isolamento & purificação , Esclerose Múltipla Recidivante-Remitente/líquido cefalorraquidiano , Esclerose Múltipla Recidivante-Remitente/virologia , Adulto , DNA Viral/líquido cefalorraquidiano , Feminino , Humanos , Imunoglobulina G/líquido cefalorraquidiano , Imageamento por Ressonância Magnética , UcrâniaRESUMO
BACKGROUND: The etiology of myocarditis in children has not yet been completely elucidated. OBJECTIVE: Medical records of eight pediatric patients diagnosed with acute myocarditis within a 41-day period in a small-town hospital were retrospectively analyzed. METHODS: We examined antibody titers of adenovirus, Epstein-Barr virus, herpes simplex virus, respiratory syncytial virus, varicella-zoster virus and cytomegalovirus in peripheral blood. We used polymerase chain reaction (PCR) amplification to detect genetic sequences from Human herpesvirus (HHV) 7, HHV 6, enterovirus, measles or parvovirus in peripheral blood. RESULTS: The causative agent was HHV 7 in four patients. HHV 7 sequences were detected through PCR in one patient with rapid deterioration. Of four patients with HHV 7, two presented with dilated cardiomyopathy. CONCLUSION: To our knowledge, this is the first report to suggest HHV 7 as a causative agent for acute myocarditis. We believe HHV 7 should be considered as a possible etiologic pathogen for patients with suspected myocarditis.
Assuntos
Surtos de Doenças , Herpesvirus Humano 7/isolamento & purificação , Miocardite/virologia , Infecções por Roseolovirus/diagnóstico , Viroses , Adolescente , Análise do Polimorfismo de Comprimento de Fragmentos Amplificados , Feminino , Herpesvirus Humano 7/genética , Humanos , Lactente , Masculino , Miocardite/complicações , Miocardite/epidemiologia , Infecções por Roseolovirus/epidemiologia , Viroses/complicações , Viroses/diagnósticoRESUMO
Pityriasis lichenoides et varioliformis acuta and pityriasis lichenoides chronica represent 2 ends of a disease spectrum of unknown etiology. Herein we describe 2 cases of pityriasis lichenoides et varioliformis acuta, in which human herpesvirus 7 DNA was detected in skin samples by polymerase chain reaction methodology, an association not previously described. This report may support the involvement of viral infection in the etiopathogeny of this disease.
Assuntos
Infecções por Herpesviridae/virologia , Herpesvirus Humano 7/isolamento & purificação , Pitiríase Liquenoide/virologia , Adulto , DNA Viral/análise , Diagnóstico Diferencial , Feminino , Infecções por Herpesviridae/diagnóstico , Herpesvirus Humano 7/genética , Herpesvirus Humano 7/patogenicidade , Humanos , Masculino , Pitiríase Liquenoide/patologia , Reação em Cadeia da Polimerase Via Transcriptase ReversaRESUMO
RESUMEN A pesar de que la Pitiriasis Rosada se considera una condición cutánea benigna, en el marco del embarazo, hay estudios que relacionan la aparición de esta patología con complicaciones asociadas en el feto. Metodología: Se realiza un reporte de caso, prospectivo, a una mujer de 36 años chilena que presentó esta patología durante la semana 12 de gestación. El objetivo fue describir, la evolución y control y contrastar su evolución con la evidencia científica actual sobre esta temática. Resultados: Paciente presenta placas eritematodescamativas concordantes con diagnóstico de pitiriasis rosada (superficie afectada menos al 50% de su cuerpo), sin presentar enantema, ni síntomas sistémicos. Tuvo un recién nacido sano a las 38 semanas de gestación, sin presentar ningún efecto adverso de los que relaciona la literatura analizada. Conclusiones: Distintos estudios han estudiado los posibles efectos adversos en el feto en madres que han presentado Pitiriasis Rosada en el embarazo, sin embargo, en este reporte de caso no se presentaron complicaciones asociadas. Faltan estudios realizados en mayor cantidad de pacientes.
ABSTRACT Although Pityriasis Rosea is considered a benign cutaneous condition, in the context of pregnancy, there are studies that relate the appearance of this pathology with associated complications in the fetus. Methodology: A prospective case report was made to a 36-year-old Chilean woman who presented this pathology during the twelve weeks of pregnancy. The objective was to describe, the evolution and control and to contrast its evolution with the current scientific evidence on this subject. Results: Patient presents concordant erythematous-desquamative plaques with diagnosis of Pityriasis Rosea (surface affected less than 50% of his body), without presenting enanthem, nor systemic symptoms. Had a healthy newborn at 38 weeks of gestation, without presenting any adverse effect related to the analyzed literature. Conclusions: Different studies have studied the possible adverse effects on the fetus in mothers who have presented pityriasis rosea in pregnancy, however in this case report there were no associated complications. Missing studies in a greater number of patients.
Assuntos
Humanos , Feminino , Gravidez , Recém-Nascido , Adulto , Pitiríase Rósea/complicações , Pitiríase Rósea/diagnóstico , Pitiríase Rósea/prevenção & controle , Complicações na Gravidez , Pitiríase Rósea/patologia , Pitiríase Rósea/virologia , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificaçãoRESUMO
Human herpes virus 7 (HHV-7) is a cause of encephalitis, meningitis and myeloradiculoneuropathy in adults who are immunocompetent or with immunosuppression. The involvement of the peripheral nervous system is always associated with myelitis. We report a case of acute polyradiculoneuropathy due to HHV-7, without involvement of central nervous system, in an immunocompetent patient. A 35-years-old man complained of lumbar pain radiating to both buttocks. On examination muscle strength and tendon reflexes were normal. He had asymmetric pinprick and light touch saddle hypoesthesia and also in the perineal region, dorsum and lateral aspect of the left foot. Magnetic resonance imaging showed mild thickening and contrast enhancement of cauda equina nerve roots. Polymerase chain reaction performed on cerebrospinal fluid was positive for HVV-7. Other inflammatory, infectious and neoplastic etiologies were ruled out. Lumbar pain and hypoesthesia improved progressively and neurological examination was normal after one month. He did not receive antiviral therapy.
Assuntos
Humanos , Masculino , Adulto , Polirradiculoneuropatia/virologia , Herpesvirus Humano 7/isolamento & purificação , Infecções por Roseolovirus/complicações , Imunocompetência , Imageamento por Ressonância Magnética , Reação em Cadeia da Polimerase , Doença AgudaRESUMO
A 28-year-old Japanese male without a significant past medical history presented with new-onset generalized clonic seizure and headache. A brain MRI revealed multiple enhanced lesions on both cerebral hemispheres. Laboratory exams showed no evidence of systemic inflammation or auto-immune antibodies such as ANCAs. Despite four courses of high-dose methylprednisolone pulse therapy and five treatments with plasmapheresis, his symptoms worsened and the MRI lesions progressed rapidly. During these treatments, we performed a targeted brain biopsy, that revealed histological findings consistent with a predominant angiitis of parenchymal and subdural small vessels. He was provided with diagnosis of central nervous system vasculitis (CNSV). Subsequent cyclophosphamide pulse therapy enabled a progressive successful improvement of his symptoms. While diagnostic methods for CNSV remain controversial, histological findings are thought to be more useful in obtaining a more definitive diagnosis than findings in image studies, such as MRI and angiography. We suggest that a brain biopsy should be considered during the early period of cases with suspected CNSV and rapid clinical deterioration. We also detected human herpesvirus 7 (HHV-7) using PCR technology in brain biopsy specimens, however the relationship between CNSV and HHV-7 infection is unknow.
Assuntos
Biópsia , Encéfalo/patologia , Vasculite do Sistema Nervoso Central/diagnóstico , Vasculite do Sistema Nervoso Central/patologia , Adulto , Encéfalo/virologia , Ciclofosfamida/administração & dosagem , Imagem de Difusão por Ressonância Magnética , Progressão da Doença , Quimioterapia Combinada , Herpesvirus Humano 7/isolamento & purificação , Humanos , Masculino , Metilprednisolona/administração & dosagem , Troca Plasmática , Prednisolona/administração & dosagem , Pulsoterapia , Resultado do Tratamento , Vasculite do Sistema Nervoso Central/terapia , Vasculite do Sistema Nervoso Central/virologiaRESUMO
BACKGROUND: Pityriasis rosea (PR) is an exanthematous disease associated with the endogenous systemic reactivation of human herpesvirus-6 (HHV-6) and human herpesvirus-7 (HHV-7). Oropharyngeal lesions may be associated with the exanthema, but anecdotal evidence suggests that few dermatologists are aware of their occurrence. OBJECTIVE: Classifying oropharyngeal lesions in PR, establishing their prevalence, and assessing their possible association with different PR forms. METHODS: The records of all PR cases diagnosed in the Dermatology Clinic of Genoa University between 2003 and 2016 were retrospectively reviewed to examine sex and age of the patients, PR type, presence of enanthema, systemic symptoms, specific anti-HHV-6 and or HHV-7 serology, and HHV-6 and/or HHV-7 DNA loads. RESULTS: The oropharyngeal mucosa was carefully examined in 527 patients with PR. Painless oropharyngeal lesions were observed in 149 patients with PR (28%) and classified as erythematomacular, macular and papular, erythematovesicular, and petechial lesions. The petechial and macular and papular patterns were those most frequently observed. There was no statistically significant difference in the levels of HHV-6 and HHV-7 viremia in the plasma of patients with enanthema and those without. LIMITATIONS: Because this was a retrospective study, biopsies on mucosal lesions were not performed. CONCLUSION: Our findings showed that enanthemas are frequently associated with forms of PR different from the classic form.
Assuntos
Doenças da Boca/epidemiologia , Doenças Faríngeas/virologia , Pitiríase Rósea/epidemiologia , Pitiríase Rósea/virologia , Adulto , Distribuição por Idade , Criança , Pré-Escolar , Estudos de Coortes , Feminino , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Humanos , Masculino , Pessoa de Meia-Idade , Doenças da Boca/fisiopatologia , Doenças da Boca/virologia , Mucosa Bucal/fisiopatologia , Mucosa Bucal/virologia , Doenças Faríngeas/epidemiologia , Doenças Faríngeas/fisiopatologia , Faringe/fisiopatologia , Faringe/virologia , Pitiríase Rósea/patologia , Prevalência , Prognóstico , Sistema de Registros , Estudos Retrospectivos , Medição de Risco , Distribuição por SexoRESUMO
BACKGROUND: Lung transplant patients are a vulnerable group of immunosuppressed patients that are prone to frequent respiratory infections. We studied 60 episodes of respiratory symptoms in 71 lung transplant patients. Almost half of these episodes were of unknown infectious etiology despite extensive routine diagnostic testing. METHODS: We re-analyzed respiratory samples of all episodes with undetermined etiology in order to detect potential viral pathogens missed/not accounted for in routine diagnostics. Respiratory samples were enriched for viruses by filtration and nuclease digestion, whole nucleic acids extracted and randomly amplified before high throughput metagenomic virus sequencing. Viruses were identified by a bioinformatic pipeline and confirmed and quantified using specific real-time PCR. RESULTS: In completion of routine diagnostics, we identified and confirmed a viral etiology of infection by our metagenomic approach in four patients (three Rhinovirus A, one Rhinovirus B infection) despite initial negative results in specific multiplex PCR. Notably, the majority of samples were also positive for Torque teno virus (TTV) and Human Herpesvirus 7 (HHV-7). While TTV viral loads increased with immunosuppression in both throat swabs and blood samples, HHV-7 remained at low levels throughout the observation period and was restricted to the respiratory tract. CONCLUSION: This study highlights the potential of metagenomic sequencing for virus diagnostics in cases with previously unknown etiology of infection and in complex diagnostic situations such as in immunocompromised hosts.
Assuntos
Infecções por Vírus de DNA/virologia , Transplante de Pulmão , Metagenoma , Complicações Pós-Operatórias/virologia , Infecções por Vírus de RNA/virologia , Infecções Respiratórias/virologia , Adulto , Infecções por Vírus de DNA/diagnóstico , Feminino , Genoma Viral , Herpesvirus Humano 7/genética , Herpesvirus Humano 7/isolamento & purificação , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Metagenômica , Pessoa de Meia-Idade , Infecções por Picornaviridae/virologia , Complicações Pós-Operatórias/diagnóstico , Infecções por Vírus de RNA/diagnóstico , Infecções Respiratórias/diagnóstico , Rhinovirus/genética , Rhinovirus/isolamento & purificação , Infecções por Roseolovirus/diagnóstico , Infecções por Roseolovirus/virologia , Torque teno virus/genética , Torque teno virus/isolamento & purificação , TransplantadosRESUMO
BACKGROUND: Primary Human herpesvirus-7 (HHV-7) infection usually occurs during childhood and causes several clinical manifestations: mainly exanthem subitum (roseola infantum), followed by a lifelong latent state with possible reactivation in case of immunodeficiency. Nevertheless, some considerably different approaches exist regarding the natural history of HHV-7 and the possible consequences of HHV-7 infection in immunocompetent adults. In particular, little is known about its pathogenic role in central nervous system (CNS) disease in nonimmunosuppressed adults. Specifically, in case of encephalitis, it is important to distinguish between infectious encephalitis and postinfectious encephalomyelitis for the management of patients CASE PRESENTATION: We describe here a case of encephalitis associated to human herpesvirus-7 with associated polymyeloradiculopathy in an immunocompetent patient which may contribute to the delineation of the approach to a patient profile with a similar clinical presentation and evolution to those presented in the literature. CONCLUSIONS: This case may alert clinicians to consider this specific etiology in the differential diagnosis of encephalopathy in patients with suspected infectious encephalitis who do not respond to acyclovir or in patients who develop acute polymyeloradiculopathy, considering that HHV-7 may be a pathological factor and that a timely diagnosis is crucial for the early administration of specific treatment.