Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Epidemiological and TNFα polymorphism evaluation in patients with cryptococcal meningitis treated at a referral hospital in North Brazil.

INTRODUCTION: The present study evaluated the epidemiology of cryptococcal meningitis and TNFα gene polymorphisms in patients at a reference hospital in northern Brazil. METHODS: Samples from 25 patients infected with Cryptococcus spp. were collected to confirm the infection and to analyze the TNFα gene polymorphisms. RESULTS: Cryptococcus neoformans was detected as the predominant etiological agent (100%) in HIV-positive patients. No genetic polymorphic changes were found. CONCLUSIONS: No correlation was observed between the analyzed TNFα polymorphisms and cryptococcal meningitis.

The Mouse Inhalation Model of Cryptococcus neoformans Infection Recapitulates Strain Virulence in Humans and Shows that Closely Related Strains Can Possess Differential Virulence.

Cryptococcal meningitis (CM) causes high rates of HIV-related mortality, yet the Cryptococcus factors influencing patient outcome are not well understood. Pathogen-specific traits, such as the strain genotype and degree of antigen shedding, are associated with the clinical outcome, but the underlying biology remains elusive. In this study, we examined factors determining disease outcome in HIV-infected cryptococcal meningitis patients infected with Cryptococcus neoformans strains with the same multilocus sequence type (MLST). Both patient mortality and survival were observed during infections with the same sequence type. Disease outcome was not associated with the patient CD4 count. Patient mortality was associated with higher cryptococcal antigen levels, the cerebrospinal fluid (CSF) fungal burden by quantitative culture, and low CSF fungal clearance. The virulence of a subset of clinical strains with the same sequence type was analyzed using a mouse inhalation model of cryptococcosis. We showed a strong association between human and mouse mortality rates, demonstrating that the mouse inhalation model recapitulates human infection. Similar to human infection, the ability to multiply in vivo, demonstrated by a high fungal burden in lung and brain tissues, was associated with mouse mortality. Mouse survival time was not associated with single C. neoformans virulence factors in vitro or in vivo; rather, a trend in survival time correlated with a suite of traits. These observations show that MLST-derived genotype similarities between C. neoformans strains do not necessarily translate into similar virulence either in the mouse model or in human patients. In addition, our results show that in vitro assays do not fully reproduce in vivo conditions that influence C. neoformans virulence.

Dynamic ploidy changes drive fluconazole resistance in human cryptococcal meningitis.

BACKGROUND: Cryptococcal meningitis (CM) causes an estimated 180,000 deaths annually, predominantly in sub-Saharan Africa, where most patients receive fluconazole (FLC) monotherapy. While relapse after FLC monotherapy with resistant strains is frequently observed, the mechanisms and impact of emergence of FLC resistance in human CM are poorly understood. Heteroresistance (HetR) - a resistant subpopulation within a susceptible strain - is a recently described phenomenon in Cryptococcus neoformans (Cn) and Cryptococcus gattii (Cg), the significance of which has not previously been studied in humans. METHODS: A cohort of 20 patients with HIV-associated CM in Tanzania was prospectively observed during therapy with either FLC monotherapy or in combination with flucytosine (5FC). Total and resistant subpopulations of Cryptococcus spp. were quantified directly from patient cerebrospinal fluid (CSF). Stored isolates underwent whole genome sequencing and phenotypic characterization. RESULTS: Heteroresistance was detectable in Cryptococcus spp. in the CSF of all patients at baseline (i.e., prior to initiation of therapy). During FLC monotherapy, the proportion of resistant colonies in the CSF increased during the first 2 weeks of treatment. In contrast, no resistant subpopulation was detectable in CSF by day 14 in those receiving a combination of FLC and 5FC. Genomic analysis revealed high rates of aneuploidy in heteroresistant colonies as well as in relapse isolates, with chromosome 1 (Chr1) disomy predominating. This is apparently due to the presence on Chr1 of ERG11, which is the FLC drug target, and AFR1, which encodes a drug efflux pump. In vitro efflux levels positively correlated with the level of heteroresistance. CONCLUSION: Our findings demonstrate for what we believe is the first time the presence and emergence of aneuploidy-driven FLC heteroresistance in human CM, association of efflux levels with heteroresistance, and the successful suppression of heteroresistance with 5FC/FLC combination therapy. FUNDING: This work was supported by the Wellcome Trust Strategic Award for Medical Mycology and Fungal Immunology 097377/Z/11/Z and the Daniel Turnberg Travel Fellowship.

Chemokine and Cytokine Cascade Caused by Skewing of the Th1-Th2 Balance Is Associated with High Intracranial Pressure in HIV-Associated Cryptococcal Meningitis.

PURPOSE: Serum cytokines/chemokines play important roles in cryptococcal meningitis, but it is unclear whether cytokines/chemokines in cerebrospinal fluid (CSF) contribute to high intracranial pressure (HICP) in HIV-associated cryptococcal meningitis (HCM). METHODS: CSF cytokines/chemokines were assayed in 17 HIV-uninfected patients, 26 HIV-infected patients without CNS infection, and 39 HCM patients at admission. Principal component analysis and correlation and logistic regression analyses were used to assess the relationships between these parameters. RESULTS: The CSF Th1, Th2, and macrophage cytokines showed an obvious increase in HCM patients as compared to the HIV-uninfected patients and HIV-infected patients without CNS infection. CSF IL-6, GM-CSF, and IL-8 were positively correlated with CSF fungal burden. Serum CD4 count, CSF Th1 cytokines (TNF-α, TNF-ß, IL-12, IL-1ß, IL-12, IL-1α, TNF-α, TNF-ß, IL-12, IL-1γ, and IL-12) and Th2 cytokines (IL-4 and IL-10) contribute to HICP. CONCLUSION: Overall, the present findings indicated that both pro- and anti-inflammatory cytokines of Th1, Th2, and macrophage origin contributed to the development of HCM. Specifically, the chemokine and cytokine cascade caused by skewing of the Th1-Th2 balance and reduced CD4 count were found to be important contributors to HICP. Summary. Our research suggested that chemokine and cytokine cascade caused by skewing of the Th1-Th2 balance in HIV-infected patients played more important role than Cryptococcus numbers and size in CSF on the development of high intracranial pressure in HIV-associated cryptococcal meningitis, providing a new understanding of mechanisms of HCM.

Epidemiological and TNFα polymorphism evaluation in patients with cryptococcal meningitis treated at a referral hospital in North Brazil

Abstract INTRODUCTION: The present study evaluated the epidemiology of cryptococcal meningitis and TNFα gene polymorphisms in patients at a reference hospital in northern Brazil. METHODS: Samples from 25 patients infected with Cryptococcus spp. were collected to confirm the infection and to analyze the TNFα gene polymorphisms. RESULTS: Cryptococcus neoformans was detected as the predominant etiological agent (100%) in HIV-positive patients. No genetic polymorphic changes were found. CONCLUSIONS: No correlation was observed between the analyzed TNFα polymorphisms and cryptococcal meningitis.

Genetic influence of Toll-like receptors on non-HIV cryptococcal meningitis: An observational cohort study.

BACKGROUND: Cryptococcal meningitis (CM) is a significant source of mortality, the pathogenesis of which has not been fully understood, especially in non-HIV infected populations. We aimed to explore the potential genetic influence of Toll-like receptor (TLR) on non-HIV CM. METHODS: This observational cohort study was done in two stages: a discovery stage and a validation stage. A case-control genetic association study was conducted between 159 non-HIV CM patients and 468 healthy controls. TLR SNPs significantly related to susceptibility went further validation in a second cohort of 583 subjects from a certain district. Associations among TLR SNPs, cerebrospinal fluid (CSF) cytokine concentrations, and clinical severity were explored in a third cohort of 99 previously untreated non-HIV CM patients. Logistic regression model was used to determine the independent predictors for disease severity. FINDINGS: In the discovery stage, eight TLR SNPs exhibited significant genetic susceptibility to non-HIV CM, one of which was validated in a population validation of HIV-infected cases while none survived in non-HIV cases. CSF cytokine detections showed that 18 cytokines were significantly over-expressed in severely ill patients. Two of the 8 SNPs (rs5743604 and rs3804099) were also significantly associated with disease severity. Specifically, the rs3804099 C/T genotype was further found to be correlated to 12 of the 18 up-regulated cytokines in severe patients. In addition, high levels of interleukin (IL)-10 in CSF (OR 2·97, 95% CI 1·49-5·90; p = 0·002) was suggested as an independent predictor for severity after adjusted for possible confounders. INTERPRETATION: TLR participates in both the occurrence and the pathogenesis of non-HIV CM. The in situ immune responses of CM were under genetic influence of TLR and contributed to disease severity. FUND: National Natural Science Foundation of China and National Key Basic Research Program of China (973 Program).

In vitro and in vivo effect of PD-1/PD-L1 blockade on microglia/macrophage activation and T cell subset balance in cryptococcal meningitis.

This study aimed to investigate the PD-1/ PD-L1 signaling pathway and its effects the activation of microglia/macrophage and balancing T cell subsets in cryptococcal meningitis (CM). A total of 126 CM patients and 126 healthy individuals were recruited for the study. The CM patients were treated with amphotericin B (AmB). Seventy five C57BL/6 mice were grouped into the normal control, CM model, CM + AmB, sham, and CM + PD-1 antibodies (Ab) groups. CD4+ and CD8+ T cells as well as microglia/macrophages were analyzed by means of flow cytometry. Ionized calcium-binding adaptor molecule 1 (Ibal) expression was detected using western blotting and immunohistochemistry techniques. And the expression of Rab5 and Rab11 were detected using an immunofluorescence assay. Both PD-1 and PD-L1 mRNA and protein expression among the mice in the study were evaluated by qRT-PCR and western blotting methods. Compared to the CM model group, the CM + AmB and CM + PD-1 Ab groups exhibited increased levels of Th1 cytokines and chemokines expression, and reduced levels of Th2 cytokines expressions. Elevated cell purity and viability of CD4+ T cell were recorded as well as increases in microglia, however, there were reductions in the number of CD8+ T cells. Depleted expressions of Ibal, Rab5, and Rab11 as well as reduced mRNA expressions of PD-1 and PD-L1 in CD4+ , microglia, and macrophage cells. The findings suggested that suppression of the PD-1/PD-L1 signaling pathway restricts the proliferation of CM by down-regulating the expressions of Th2 cells and suppressing microglia and macrophage activation.

A Population Genomics Approach to Assessing the Genetic Basis of Within-Host Microevolution Underlying Recurrent Cryptococcal Meningitis Infection.

Recurrence of meningitis due to Cryptococcus neoformans after treatment causes substantial mortality in HIV/AIDS patients across sub-Saharan Africa. In order to determine whether recurrence occurred due to relapse of the original infecting isolate or reinfection with a different isolate weeks or months after initial treatment, we used whole-genome sequencing (WGS) to assess the genetic basis of infection in 17 HIV-infected individuals with recurrent cryptococcal meningitis (CM). Comparisons revealed a clonal relationship for 15 pairs of isolates recovered before and after recurrence showing relapse of the original infection. The two remaining pairs showed high levels of genetic heterogeneity; in one pair we found this to be a result of infection by mixed genotypes, while the second was a result of nonsense mutations in the gene encoding the DNA mismatch repair proteins MSH2, MSH5, and RAD5 These nonsense mutations led to a hypermutator state, leading to dramatically elevated rates of synonymous and nonsynonymous substitutions. Hypermutator phenotypes owing to nonsense mutations in these genes have not previously been reported in C. neoformans, and represent a novel pathway for rapid within-host adaptation and evolution of resistance to first-line antifungal drugs.

Molecular diagnosis of invasive mycoses of the central nervous system.

INTRODUCTION: In September 2012, the Centers for Disease Control and Prevention (CDC) began investigating an outbreak of fungal meningitis among patients who had received contaminated preservative-free methyl prednisolone acetate injections from the New England Compounding Center in Framingham, Massachusetts. Thousands of patients were potentially exposed to tainted corticosteroids, but establishing the diagnosis of fungal meningitis during the nationwide outbreak was difficult because little was known about the natural history of the disease. Areas covered: The challenges associated with this outbreak highlighted the need for rapid and reliable methodologies to assist in the diagnosis of invasive mycoses of the central nervous system (IMCNS), which may be devastating and difficult to treat. In this paper, we review the causative agents of these potentially-lethal infections, which include cryptococcal meningitis, cerebral aspergillosis, and hematogenous Candida meningoencephalitis. Expert commentary: While microscopy, culture, and histopathologic identification of fungal pathogens remain the gold standard for diagnosis, new platforms and species-specific assays have recently emerged, including lateral flow immunoassays (LFA), matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), and multiplex PCR in conjunction with magnetic resonance (MR) to potentially aid in the diagnosis of IMCNS.

Alpha7 nicotinic acetylcholine receptor is required for blood-brain barrier injury-related CNS disorders caused by Cryptococcus neoformans and HIV-1 associated comorbidity factors.

BACKGROUND: Cryptococcal meningitis is the most common fungal infection of the central nervous system (CNS) in HIV/AIDS. HIV-1 virotoxins (e.g., gp41) are able to induce disorders of the blood-brain barrier (BBB), which mainly consists of BMEC. Our recent study suggests that α7 nAChR is an essential regulator of inflammation, which contributes to regulation of NF-κB signaling, neuroinflammation and BBB disorders caused by microbial (e.g., HIV-1 gp120) and non-microbial [e.g., methamphetamine (METH)] factors. However, the underlying mechanisms for multiple comorbidities are unclear. METHODS: In this report, an aggravating role of α7 nAChR in host defense against CNS disorders caused by these comorbidities was demonstrated by chemical [inhibitor: methyllycaconitine (MLA)] and genetic (α7(-/-) mice) blockages of α7 nAChR. RESULTS: As shown in our in vivo studies, BBB injury was significantly reduced in α7(-/-) mice infected with C. neoformans. Stimulation by the gp41 ectodomain peptide (gp41-I90) and METH was abolished in the α7(-/-) animals. C. neoformans and gp41-I90 could activate NF-κB. Gp41-I90- and METH-induced monocyte transmigration and senescence were significantly inhibited by MLA and CAPE (caffeic acid phenethyl ester, an NF-κB inhibitor). CONCLUSIONS: Collectively, our data suggest that α7 nAChR plays a detrimental role in the host defense against C. neoformans- and HIV-1 associated comorbidity factors-induced BBB injury and CNS disorders.

Characterization of host response to Cryptococcus neoformans through quantitative proteomic analysis of cryptococcal meningitis co-infected with HIV.

Cryptococcal meningitis is the most common opportunistic fungal infection causing morbidity and mortality (>60%) in HIV-associated immunocompromised individuals caused by Cryptococcus neoformans. Molecular mechanisms of cryptococcal infection in brain have been studied using experimental animal models and cell lines. There are limited studies for the molecular understanding of cryptococcal meningitis in human brain. The proteins involved in the process of invasion and infection in human brain still remains obscure. To this end we carried out mass spectrometry-based quantitative proteomics of frontal lobe brain tissues from cryptococcal meningitis patients and controls to identify host proteins that are associated with the pathogenesis of cryptococcal meningitis. We identified 317 proteins to be differentially expressed (≥2-fold) from a total of 3423 human proteins. We found proteins involved in immune response and signal transduction to be differentially expressed in response to cryptococcal infection in human brain. Immune response proteins including complement factors, major histocompatibility proteins, proteins previously known to be involved in fungal invasion to brain such as caveolin 1 and actin were identified to be differentially expressed in cryptococcal meningitis brain tissues co-infected with HIV. We also validated the expression status of 5 proteins using immunohistochemistry. Overexpression of major histocompatibility complexes, class I, B (HLA-B), actin alpha 2 smooth muscle aorta (ACTA2) and caveolin 1 (CAV1) and downregulation of peripheral myelin protein 2 (PMP2) and alpha crystallin B chain (CRYAB) in cryptococcal meningitis were confirmed by IHC-based validation experiments. This study provides the brain proteome profile of cryptococcal meningitis co-infected with HIV for a better understanding of the host response associated with the disease.

Genotypic Diversity Is Associated with Clinical Outcome and Phenotype in Cryptococcal Meningitis across Southern Africa.

Cryptococcal meningitis is a major cause of mortality throughout the developing world, yet little is known about the genetic markers underlying Cryptococcal virulence and patient outcome. We studied a cohort of 230 Cryptococcus neoformans (Cn) isolates from HIV-positive South African clinical trial patients with detailed clinical follow-up using multi-locus sequence typing and in vitro phenotypic virulence assays, correlating these data with clinical and fungal markers of disease in the patient. South African Cn displayed high levels of genetic diversity and locus variability compared to globally distributed types, and we identified 50 sequence types grouped within the main molecular types VNI, VNII and VNB, with 72% of isolates typed into one of seven 'high frequency' sequence types. Spatial analysis of patients' cryptococcal genotype was not shown to be clustered geographically, which might argue against recent local acquisition and in favour of reactivation of latent infection. Through comparison of MLST genotyping data with clinical parameters, we found a relationship between genetic lineage and clinical outcome, with patients infected with the VNB lineage having significantly worse survival (n=8, HR 3.35, CI 1.51-7.20, p=0.003), and this was maintained even after adjustment for known prognostic indicators and treatment regimen. Comparison of fungal genotype with in vitro phenotype (phagocytosis, laccase activity and CSF survival) performed on a subset of 89 isolates revealed evidence of lineage-associated virulence phenotype, with the VNII lineage displaying increased laccase activity (p=0.001) and ex vivo CSF survival (p=0.0001). These findings show that Cryptococcus neoformans is a phenotypically heterogeneous pathogen, and that lineage plays an important role in cryptococcal virulence during human infection. Furthermore, a detailed understanding of the genetic diversity in Southern Africa will support further investigation into how genetic diversity is structured across African environments, allowing assessment of the risks different ecotypes pose to infection.

Unusual galactofuranose modification of a capsule polysaccharide in the pathogenic yeast Cryptococcus neoformans.

Galactofuranose (Galf) is the five-membered ring form of galactose. Although it is absent from mammalian glycans, it occurs as a structural and antigenic component of important cell surface molecules in a variety of microbes, ranging from bacteria to parasites and fungi. One such organism is Cryptococcus neoformans, a pathogenic yeast that causes lethal meningoencephalitis in immunocompromised individuals, particularly AIDS patients. C. neoformans is unique among fungal pathogens in bearing a complex polysaccharide capsule, a critical virulence factor reported to include Galf. Notably, how Galf modification contributes to the structure and function of the cryptococcal capsule is not known. We have determined that Galf is ß1,2-linked to an unusual tetrasubstituted galactopyranose of the glucuronoxylomannogalactan (GXMGal) capsule polysaccharide. This discovery fills a longstanding gap in our understanding of a major polymer of the cryptococcal capsule. We also engineered a C. neoformans strain that lacks UDP-galactopyranose mutase; this enzyme forms UDP-Galf, the nucleotide sugar donor required for Galf addition. Mutase activity was required for the incorporation of Galf into glucuronoxylomannogalactan but was dispensable for vegetative growth, cell integrity, and virulence in a mouse model.

Association of Fcγ receptor IIB polymorphism with cryptococcal meningitis in HIV-uninfected Chinese patients.

BACKGROUND: As important regulators of the immune system, the human Fcγ receptors (FcγRs) have been demonstrated to play important roles in the pathogenesis of various infectious diseases. The aim of the present study was to identify the association between FCGR polymorphisms and cryptococcal meningitis. METHODOLOGY/PRINCIPAL FINDINGS: In this case control genetic association study, we genotyped four functional polymorphisms in low-affinity FcγRs, including FCGR2A 131H/R, FCGR3A 158F/V, FCGR3B NA1/NA2, and FCGR2B 232I/T, in 117 patients with cryptococcal meningitis and 190 healthy controls by multiplex SNaPshot technology. Among the 117 patients with cryptococcal meningitis, 59 had predisposing factors. In patients with cryptococcal meningitis, the FCGR2B 232I/I genotype was over-presented (OR = 1.652, 95% CI [1.02-2.67]; P = 0.039) and the FCGR2B 232I/T genotype was under-presented (OR = 0.542, 95% CI [0.33-0.90]; P = 0.016) in comparison with control group. In cryptococcal meningitis patients without predisposing factors, FCGR2B 232I/I genotype was also more frequently detected (OR = 1.958, 95% CI [1.05-3.66]; P = 0.033), and the FCGR2B 232I/T genotype was also less frequently detected (OR = 0.467, 95% CI [0.24-0.91]; P = 0.023) than in controls. No significant difference was found among FCGR2A 131H/R, FCGR3A 158F/V, and FCGR3B NA1/NA2 genotype frequencies between patients and controls. CONCLUSION/SIGNIFICANCE: We found for the first time associations between cryptococcal meningitis and FCGR2B 232I/T genotypes, which suggested that FcγRIIB might play an important role in the central nervous system infection by Cryptococcus in HIV-uninfected individuals.

Genotypes coding for mannose-binding lectin deficiency correlated with cryptococcal meningitis in HIV-uninfected Chinese patients.

BACKGROUND: There is increasing evidence that mannose-binding lectin (MBL) has a complex role in many diseases, particularly in infectious diseases. However, the relationship between MBL deficiency and cryptococcal meningitis has not been clarified. The purpose of this study was to investigate the correlation between MBL polymorphism and non-HIV cryptococcal meningitis. METHODS: A case-controlled genetic association study was conducted. Patients with cryptococcal meningitis and control subjects were genotyped for 6 alleles of MBL2 gene (H/L, Y/X, P/Q, A/D, A/B, and A/C). The distributions in allele frequency, genotypes, haplotypes, and genotype groups were compared between patients and control subjects. RESULTS: Study participants included 103 HIV-uninfected patients with cryptococcal meningitis and 208 healthy control subjects, all of Chinese Han ethnicity. The homozygous mutative genotypes (O/O) of the coding region were associated with cryptococcal meningitis (P = .023; odds ratio [OR], 4.29; 95% confidence interval [CI], 1.11-19.88), the correlation more overt in immunocompetent patients (P = .005; OR, 6.65; 95% CI, 1.49-33.05). MBL-deficient participant group was associated with cryptococcal meningitis (P = .039; OR, 2.09; 95% CI, .96-4.51), particularly in immunocompetent patients (P = .028; OR, 2.51; 95% CI, .96-6.22). CONCLUSIONS: This is the first to show genotypes coding for MBL deficiency are associated with cryptococcal meningitis in nonimmunocompromised hosts.

BLyS and APRIL expression in peripheral blood mononuclear cells of cryptococcal meningitis patients and their clinical significance.

OBJECTIVE: To investigate the levels of APRIL, BlyS and receptors as TACI, BCMA and BAFF-R in peripheral blood mononuclear cells (PBMC) of cryptococcal meningitis (CM) patients and its clinical significance. METHODS: PBMC from 30 CM patients and 32 healthy controls were isolated. The mRNA levels of APRIL, BLyS and BLyS receptors were detected by fluorescent quantitation PCR. The effect of PBMC from CM patients on in vitro growth of Cryptococcus neoformans was compared in presence and absence of BLyS. RESULTS: PBMC of CM patients exhibited significantly lower BLyS, TACI and BCMA mRNA levels but significantly higher BAFF-R mRNA levels than controls. Growth of C. neoformans was significantly slower in presence of BLyS than its absence. CONCLUSION: Levels of BlyS and its receptors correlated with cryptococcal meningitis progression, and provide new clues for monitoring CM conditions and its effective therapy.

Infectomic analysis of gene expression profiles of human brain microvascular endothelial cells infected with Cryptococcus neoformans.

In order to dissect the pathogenesis of Cryptococcus neoformans meningoencephalitis, a genomic survey of the changes in gene expression of human brain microvascular endothelial cells infected by C. neoformans was carried out in a time-course study. Principal component analysis (PCA) revealed significant fluctuations in the expression levels of different groups of genes during the pathogen-host interaction. Self-organizing map (SOM) analysis revealed that most genes were up- or downregulated 2 folds or more at least at one time point during the pathogen-host engagement. The microarray data were validated by Western blot analysis of a group of genes, including beta-actin, Bcl-x, CD47, Bax, Bad, and Bcl-2. Hierarchical cluster profile showed that 61 out of 66 listed interferon genes were changed at least at one time point. Similarly, the active responses in expression of MHC genes were detected at all stages of the interaction. Taken together, our infectomic approaches suggest that the host cells significantly change the gene profiles and also actively participate in immunoregulations of the central nervous system (CNS) during C. neoformans infection.

MHC class II-positive perivascular microglial cells mediate resistance to Cryptococcus neoformans brain infection.

Acquired resistance to the CNS pathogen Cryptococcus neoformans is mediated by CD4(+) T lymphocytes primed by exposure to antigen in the context of major histocompatibility class II (MHC II) molecules. In mouse brain, parenchymal and perivascular microglial cells may express interferon-gamma (IFN-gamma)-inducible MHC class II marker and thus interact with CD4(+) T cells. Primed effector T cells are retained in the infected CNS if antigen is encountered in proper MHC context and may deliver signals that potentiate microglia to enhanced fungistasis. Vaccinated C57BL6/J mice resist an ordinarily lethal C. neoformans rechallenge, but identically treated congenic Abeta(o/o) mice (MHC class II-deficient; CD4(+) T-cell-deficient) do not. Nor can Abeta(o/o) mice be adoptively immunized by infusion of lymphocytes from vaccinated C57BL6/J donors, as are severe combined immunodeficient (SCID) mice (MHC class II-intact, lymphocyte-deficient). Chimeric (C57BL/6J:Abeta(o/o)) mice with class II expression likely on perivascular microglia only were, like SCID mice, capable of adoptive immunization against C. neoformans brain infection. To the contrary, chimeric mice with class II expression likely only on parenchymal microglia were not capable of effective adoptive immunization against C. neoformans brain infection. Therefore, in order to mediate resistance to infection, primed CD4(+) T cells must interact with the replenishable perivascular microglial subset that lies in close proximity to cerebral vasculature. Although T cells may supply help in the form of inflammatory cytokines to parenchymal microglia, expression of class II on these cells appears unnecessary for antifungal activity.

The STE12alpha homolog is required for haploid filamentation but largely dispensable for mating and virulence in Cryptococcus neoformans.

Cryptococcus neoformans is a fungal pathogen that causes meningitis in immunocompromised hosts. The organism has a known sexual cycle, and strains of the MATalpha mating type are more virulent than isogenic MATa strains in mice, and they are more common in the environment and infected hosts. A C. neoformans homolog of the STE12 transcription factor that regulates mating, filamentation, and virulence in Saccharomyces cerevisiae and Candida albicans was identified previously, found to be encoded by a novel region of the MATalpha mating type locus, and shown to enhance filamentous growth when overexpressed. We have disrupted the C. neoformans STE12 gene in a pathogenic serotype A isolate. ste12 mutant strains exhibit a severe defect in filamentation and sporulation (haploid fruiting) in response to nitrogen starvation. In contrast, ste12 mutant strains have only modest mating defects and are fully virulent in two animal models compared to the STE12 wild-type strain. In genetic epistasis experiments, STE12 functions in a MAP kinase cascade to regulate fruiting, but not mating. Thus, the C. neoformans STE12alpha transcription factor homolog plays a specialized function in haploid fruiting, but it is dispensable or redundant for mating and virulence. The association of the MATalpha locus with virulence may involve additional genes, and other transcription factors that regulate mating and virulence remain to be identified.