Relationship between Mycoplasma mycoides subsp. mycoides ('large-colony' strains) and M. mycoides subsp. capri, as indicated by numerical analysis of one-dimensional SDS-PAGE protein patterns.

Twenty-five strains classified as Mycoplasma mycoides subsp. mycoides LC or subsp. capri have been compared by one-dimensional SDS-PAGE of their cellular proteins. A computerized numerical analysis revealed that the protein patterns of all but two aberrant strains formed one large phenon that separated clearly from representatives of the four other members of the 'M. mycoides cluster' at a similarity level (S) of 66% and which remained undivided at up to 78% S. At higher similarity levels, these strains fell heterogeneously into mixed sub-phenons containing strains of both subspecies. Serological comparisons by immunofluorescence largely confirmed the subspecies designations of the test strains, but also showed that some were serologically intermediate between subsp. mycoides and subsp. capri, being cross-reactive with both. These results confirm and enlarge upon those of our earlier studies indicating the protein-pattern inseparability of subsp. capri and subsp. mycoides LC strains and their distinctiveness from the classical M. mycoides subsp. mycoides SC strains and other members of the 'M. mycoides cluster'. As also recognized by other workers, subsp. mycoides LC and subsp. capri strains appear to comprise one large group, wherein those most readily identifiable as either type lie at either end of a serological spectrum that also contains serologically cross-reactive strains. Our observations therefore suggest the lines along which the three groups classified at present within the species M. mycoides (SC and LC strains of subsp. mycoides; subsp. capri) might eventually be reclassified, subject to direct genomic comparisons.

Synthesis of galactofuranose disaccharides of biological significance.

Methyl beta-D-galactofuranoside was readily obtained by tin(IV) chloride-catalyzed glycosylation of penta-O-benzoyl-alpha,beta-D-galactofuranose, followed by debenzoylation with sodium methoxide. Glycosylation of 1 with 2,3,5-tri-O-benzoyl-D-galactono-1,4-lactone or with the 6-O-trityl-lactone derivative 5 gave the benzoylated beta-D-galactofuranosyl-(1----6)-D-galactono-1,4-lactone 6 in excellent yield. The structure of disaccharide 6 was confirmed by borohydride reduction to the glycosyl-alditol 7. A byproduct of the condensation reaction of 1 with 4 or 5 was identified as the benzoylated (1----1)-beta,beta'-D-galactofuranosyl disaccharide 8. Compound 8 was readily prepared (88% yield) by controlled addition of water to 1, in the presence of stannic chloride. O-Debenzoylation of 8 afforded crystalline beta'-D-galactofuranosyl-(1----1)-beta-D-galactofuranoside. The glycosyl-lactone 6 constitutes a key intermediate for the synthesis of a disaccharide derivative having both units in the furanoid form. Thus, diisoamylborane reduction of the lactone function of 6 led to the disaccharide derivative 10, from which the methyl glycoside 12 was prepared. O-Debenzoylation of 12 gave the corresponding methyl beta-D-galactofuranosyl-(1----6)-beta-D-galactofuranoside. The free disaccharide beta-D-Galf-(1----6)-D-Galp and its acetylated derivative were also synthesized from 10.

Emmy Klieneberger-Nobel Award Lecture: The protein fingerprints of mycoplasmas.

The proteins of 91 strains of Mycoplasma from 19 established species and three groups of uncertain taxonomic position were separated by two-dimensional polyacrylamide gel electrophoresis. Considerable variations in protein patterns were found among strains from the same species or subspecies; the percentage of matching spots (% of congruence) ranged from 42%-100%, but many proteins were strongly conserved in all strains of a given species. Maps of these conserved proteins could be used to identify strains. It was concluded that (1) large colony-type strains of Mycoplasma mycoides subspecies mycoides are more closely related to M. mycoides subspecies capri than to small colony-type strains of M. mycoides subspecies mycoides; (2) Mycoplasma capricolum, Leach group 7, and the F38 group of mycoplasmas are all related to M. mycoides; (3) the 2D group of strains are not related to either M. mycoides or Mycoplasma bovis, (4) M. bovis and Mycoplasma agalactiae are closely related; (5) apart from a small overlap in pattern between Acholeplasma laidlawii and Acholeplasma granularum, the type strains of seven established species of Acholeplasma each had distinct protein patterns that justified their classification as separate species; and (6) analysis of two-dimensional protein patterns is a valuable method for resolving problems in mycoplasma taxonomy and for identifying strains.

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.

The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri.

The nucleotide sequence of Mycoplasma mycoides sp. capri PG3 formylmethionine tRNA has been determined, using in vitro labeling techniques, to be pC-G-C-G-G-G-G-s4U-A-G-A-G-C-A-G-U-D (U)-G-G-D-A-G-C-U-C-G-C-C-G-G-G-C-U-C-A-U-A-A-C-C-C-G-G-A-G-G-C-C-G-C-A-G-G-U-psi- C-G-A-G-U-C-C-U-G-C-C-C-C-C-G-C-A-A-C-C-AOH. This tRNA contains only three modified nucleosides s4U, D and psi, all of which are derived from uridine. Both in the structural features which distinguish eukaryotic from prokaryotic initiator RNAs and in the overall sequence, this tRNA resembles a typical prokaryotic initiator tRNA. A comparison of the sequence of this tRNA with those of other prokaryotic initiator tRNAs suggests that taxonomically the Mycoplasma may be less related to the Cyanophyta (Anacystis nidulans) than to the bacteria and less related to the Enterobacteriaceae (Escherichia coli) than to the Bacillaceae (Bacillus subtilis).

Isoelectric focusing of mycoplasma proteins.

Polyacrylamide gel isoelectric focusing (PAGIF) in thin layer was used to resolve proteins of Mycoplasma spp., Acholeplasma spp., and eight strains of Ureaplasma urealyticum (T-strain). A mixture of urea, Triton X-100, and dithioerythritol was used to solubilize sonically disrupted cells. PAGIF was performed in the range of pH 3 to 10. Protein patterns were carefully compared, demonstrating resolved and distinguishable species-specific protein bands. The eight serotypes of U. urealyticum (T-strain) gave identical protein patterns in the pH 3 to 10 range. The characteristic "fingerprints" of a species appeared to correlate with the biochemical nature and not the habitat in each case. Arginine-hydrolyzing species seemed to show more diverse focusing than those that ferment glucose, or prefer an acid environment. Characterization and identification of highly resolved species-specific proteins, ease of performance, and reproducibility of this method suggest that PAGIF might be employed as a taxonomic aid.

Formylatable methionine transfer RNA from Mycoplasma: purification and comparison of partial nucleotide sequences with those of other prokaryotic initiator tRNAs.

The major species of the formylatable methionine tRNA from Mycoplasma mycoides var capri has been purified. The 5'- and 3'-terminal sequences of the purified tRNA are pC-G- and C-A-A-C-C-AOH, respectively. Thus, this tRNA also contains the unique structural feature found in two other prokaryotic initiator tRNAs in that the first nucleotide at the 5'-end cannot form a Watson-Crick type of base-pair to the fifth nucleotide from the 3'-end. The Mycoplasma tRNA does not contain ribothymidine; however, a specific uridine residue in the sequence G-U-psi-C-G- can be enzymatically methylated by E. coli extracts to yield G-T-psi-C-G. Since ribothymidine is absent in crude tRNA from this strain of Mycoplasma, the absence of T is probably due to the lack of a U yields T modifying enzyme.

Studies with lectins on the surface carbohydrate structures of mycoplasma membranes.

The surface carbohydrate structures on the cell membranes of various mycoplasma species have been investigated by using lectins, which are sugar-specific proteins. Carbohydrate structures presumably bound to glycolipids, with both galactose and glucose units, were found to be exposed on the surface of Mycoplasma pneumoniae and its temperature-sensitive mutants, M. mycoides var. mycoides and capri, M. pulmonis, M. gallinarum, and M. gallisepticum. Lipid-bound glucose was found on M. neurolyticum. The possible relationship of the lipid-bound surface carbohydrate groups to the known serological cross-reactions and lipid compositions of the various mycoplasma species is discussed. Intact Acholeplasma laidlawii and M. fermentans have no lectin-binding sites exposed on their surfaces; galactose groups were discovered only after Pronase digestion of the organisms, suggesting that their glycolipids are hidden under a protein layer. Neither intact nor Pronase-digested M. hominis reacted with the lectins; this is fully consistent with the lipid composition of this organism, which contains glycolipids. The lectins from Vicia cracca and Phaseolus vulgaris, which react with N-acetyl-galactosamine groups, agglutinated M. gallinarum, M. gallisepticum, M. mycoides var. capri, and M. pulmonis. The agglutinability was lost after Pronase treatment, indicating that the corresponding carbohydrates are presumably protein bound. They may be correlated with the extracellular structures observed by electron microscopy of both sectioned and negatively stained mycoplasma species.

Immunoelectrophoretic analysis of Mycoplasma mycoides var. mycoides.

Acrylamide gel electrophoresis was used to show the similarities and differences in the membrane proteins of two vaccine and two virulent strains of Mycoplasma mycoides var. mycoides. Immunoelectrophoretic (IEP) analysis was also used to partially characterize the associated antigens. Antibody spectra to the antigens of M. mycoides differ in rabbit, pig, and cattle sera. Rabbits produce better precipitating antibody against the anodic migrating protein mycoplasma antigens than cattle and pigs as seen in IEP. However, rabbit anti-M. mycoides serum did not show precipitating antibody against the heat-stable carbohydrate antigen. As judged by IEP, the major carbohydrate antigen extracted from the media, or boiled whole organism, is similar to that present in the sera-infected cattle and knee joints of calves. This carbohydrate antigen has a cathodic migration in IEP at pH 8.6. Periodate oxidation, classically used to destroy carbohydrate, also destroys most of the protein antigens. Heating the antigens to 56 C for 10 min destroys many of the noncarbohydrate antigens and 100 C eliminates all but the carbohydrate antigen. Extraction of M. mycoides with chloroform-methanol, phenol, ethanol, or ethanol-acetone reduced or eliminated most of the protein antigens. Some of the isolated antigenic fractions of M. mycoides were tested to determine their activity in the diagnostic complement fixation test for contagious bovine pleuropneumonia and their inhibitory effect in this test by using bovine anti-M. mycoides antisera having precipitating antibody and circulating antigen. The complement fixation antigen is not the galactan, cannot be extracted by chloroform-methanol, but is stable to boiling at 100 C and may be extracted by phenol and partially precipitated by ethanol-acetone.

Acyl carrier protein in mycoplasmas.

Acyl carrier protein (ACP) activity was determined by the malonyl-coenzyme A-CO(2) exchange reaction. It was highest in Acholeplasma laidlawii, lower in A. granularum, and lowest in A. axanthum. The sterol-requiring Mycoplasma species examined showed little or negligible ACP activity. A. laidlawii was capable of utilizing pantetheine or coenzyme A but not beta-alanine as precursor for ACP synthesis. Its ACP could thus be labeled by growing the organisms with radioactive coenzyme A. The ACP of A. laidlawii appears to be a soluble cytoplasmic protein, which could be purified about 40-fold by treatment of the cytoplasmic fluid with streptomycin sulfate and chromatography of the supernatant fluid on a Biogel P-10 column. Its molecular weight, determined by polyacrylamide gel electrophoresis, is low (about 10,900) resembling that of Escherichia coli, but it is much more sensitive to heat.

Divalent cations in native and reaggregated mycoplasma membranes.

The Mg(2+) content of membranes of several Mycoplasma and Acholeplasma species varied between 0.88 and 1.98 mug of Mg(2+) per mg of protein, depending on the species and on growth conditions. Ca(2+) could be detected only when it was added to the growth medium. The Mg(2+) content of isolated A. laidlawii membranes could be increased almost threefold by dialysis against 20 mm Mg(2+), whereas aggregated A. laidlawii membranes contained about six to eight times more Mg(2+) per mg of protein than the native membranes. This was taken to indicate that the molecular organization of the lipid and protein in the reaggregated membranes differs from that of the native membranes. Between 60 and 83% of the Mg(2+) in native and reaggregated A. laidlawii membranes was associated with the lipid fraction extracted with chloroform-methanol. The removal of over 80% of membrane protein by Pronase digestion did not release any significant amount of Mg(2+). Hence, most of the divalent cation appears to be bound to membrane lipids, most probably to phospholipids. Ethylenediaminetetraacetic acid released the bulk of Mg(2+) bound to the native and reaggregated A. laidlawii membranes, except for about 0.5 mug of Mg(2+) per mg of protein which was too tightly bound. Hence, a small but fairly constant amount of Mg(2+) is unavailable for chelation.