RESUMO
OBJECTIVE: To systematically describe the short stature of patients with Diamond-Blackfan anemia and to explore factors affecting the height development of patients with Diamond-Blackfan anemia. STUDY DESIGN: This cross-sectional study was conducted at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, and the height, weight, and clinical data of 129 patients with Diamond-Blackfan anemia were collected from June 2020 to September 2020. RESULTS: The median height-age-z score (HAZ) of children affected by Diamond-Blackfan anemia was -1.54 (-6.36-1.96). Short stature was found in 37.98% of the patients. Specific Diamond-Blackfan anemia growth curves were developed for weight, height, and body mass index, separately for male and female patients. Multivariable logistic regression models showed that female sex (aOR 4.92; 95% CI 1.29-18.71; P = .0195), underweight (aOR 10.41, 95% CI 1.41-76.98, P = .0217), cardiovascular malformations (aOR 216.65; 95% CI 3.29-14279.79; P = .0118), and RPL11(aOR 29.14; 95% CI 1.18-719.10; P = .0392) or RPS26 (aOR 53.49; 95% CI 1.40-2044.30; P = .0323) mutations were independent risk factors for short stature. In the subgroup of patients who were steroid-dependent, patients with a duration of steroid therapy over 2 years (OR 2.95; 95% CI 1.00-8.66; P = .0494) or maintenance dose of prednisone >0.1 mg/kg per day (OR 3.30; 95% CI 1.02-10.72; P = .0470) had a higher incidence of short stature. CONCLUSIONS: Patients with Diamond-Blackfan anemia had a high prevalence of short stature. The risk of short stature increased with age and was associated with sex, underweight, congenital malformations, and RPL11 or RPS26 mutations. The duration of steroid therapy and maintenance dose of steroid was significantly associated with the incidence of short stature in steroid-dependent patients with Diamond-Blackfan anemia.
Assuntos
Anemia de Diamond-Blackfan/epidemiologia , Nanismo/epidemiologia , Anormalidades Múltiplas/epidemiologia , Adolescente , Fatores Etários , Anemia de Diamond-Blackfan/tratamento farmacológico , Anemia de Diamond-Blackfan/genética , Criança , Pré-Escolar , China , Estudos Transversais , Nanismo/etiologia , Feminino , Glucocorticoides/administração & dosagem , Glucocorticoides/efeitos adversos , Humanos , Lactente , Masculino , Mutação , Prednisona/administração & dosagem , Prednisona/efeitos adversos , Proteínas Ribossômicas , Fatores SexuaisRESUMO
The complexity of skeletal pathologies makes use of in vivo models essential to elucidate the pathogenesis of the diseases; nevertheless, chondrocyte and osteoblast cell lines provide relevant information on the underlying disease mechanisms. Due to the limitations of primary chondrocytes, immortalized cells represent a unique tool to overcome this problem since they grow very easily for several passages. However, in the immortalization procedure the cells might lose the original phenotype; thus, these cell lines should be deeply characterized before their use. We immortalized primary chondrocytes from a Cant1 knock-out mouse, an animal model of Desbuquois dysplasia type 1, with a plasmid expressing the SV40 large and small T antigen. This cell line, based on morphological and biochemical parameters, showed preservation of the chondrocyte phenotype. In addition reduced proteoglycan synthesis and oversulfation of glycosaminoglycan chains were demonstrated, as already observed in primary chondrocytes from the Cant1 knock-out mouse. In conclusion, immortalized Cant1 knock-out chondrocytes maintained the disease phenotype observed in primary cells validating the in vitro model and providing an additional tool to further study the proteoglycan biosynthesis defect. The same approach might be extended to other cartilage disorders.
Assuntos
Hidrolases Anidrido Ácido/fisiologia , Condrócitos/patologia , Anormalidades Craniofaciais/patologia , Nanismo/patologia , Glicosaminoglicanos/metabolismo , Instabilidade Articular/patologia , Ossificação Heterotópica/patologia , Fenótipo , Polidactilia/patologia , Animais , Linhagem Celular Transformada , Condrócitos/metabolismo , Anormalidades Craniofaciais/etiologia , Anormalidades Craniofaciais/metabolismo , Nanismo/etiologia , Nanismo/metabolismo , Instabilidade Articular/etiologia , Instabilidade Articular/metabolismo , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Ossificação Heterotópica/etiologia , Ossificação Heterotópica/metabolismo , Polidactilia/etiologia , Polidactilia/metabolismoRESUMO
AIMS: To investigate genotype and phenotype of congenital nephrogenic diabetes insipidus caused by AVPR2 mutations, which is rare and limitedly studied in Chinese population. METHODS: 88 subjects from 28 families with NDI in a department (Beijing, PUMCH) were screened for AVPR2 mutations. Medical records were retrospectively reviewed and characterized. Genotype and phenotype analysis was performed. RESULTS: 23 AVPR2 mutations were identified, including six novel mutations (p.Y117D, p.W208R, p.L313R, p.S127del, p.V162Sfs*30 and p.G251Pfs*96). The onset-age ranged from 1 week to 3 years. Common presentations were polydipsia and polyuria (100%) and intermittent fever (57%). 21% and 14% of patients had short stature and mental impairment. Urine SG and osmolality were decreased, while serum osmolality and sodium were high. Urological ultrasonography results showed hydronephrosis of the kidney (52%), dilation of the ureter (48%), and thickened bladder wall or increased residual urine (32%), led to intermittent urethral catheterization (7%), cystostomy (11%) and binary nephrostomy (4%). Urological defects were developed in older patients. Genotype and phenotype analysis revealed patients with non-missense mutations had higher levels of serum sodium than missense mutations. CONCLUSION: In the first and largest case series of NDI caused by AVPR2 mutations in Chinese population, we established genetic profile and characterized clinical data, reporting six novel mutations. Further, we found genotype was associated with phenotype. This knowledge broadens genotype and phenotype spectrum of rare congenital NDI caused by AVPR2 mutations, and provides basis for studying molecular biology of AVPR2.
Assuntos
Disfunção Cognitiva , Diabetes Insípido Nefrogênico , Nanismo , Receptores de Vasopressinas/genética , Doenças Urológicas , Adolescente , Idade de Início , China/epidemiologia , Disfunção Cognitiva/epidemiologia , Disfunção Cognitiva/genética , Diabetes Insípido Nefrogênico/diagnóstico , Diabetes Insípido Nefrogênico/epidemiologia , Diabetes Insípido Nefrogênico/genética , Diabetes Insípido Nefrogênico/psicologia , Técnicas de Diagnóstico Urológico , Nanismo/diagnóstico , Nanismo/etiologia , Estudos de Associação Genética , Humanos , Mutação , Concentração Osmolar , Linhagem , Ultrassonografia/métodos , Urinálise/métodos , Doenças Urológicas/congênito , Doenças Urológicas/epidemiologiaRESUMO
Filamins (FLN) are a family of actin-binding proteins involved in regulating the cytoskeleton and signaling phenomenon by developing a network with F-actin and FLN-binding partners. The FLN family comprises three conserved isoforms in mammals: FLNA, FLNB, and FLNC. FLNB is a multidomain monomer protein with domains containing an actin-binding N-terminal domain (ABD 1-242), encompassing two calponin-homology domains (assigned CH1 and CH2). Primary variants in FLNB mostly occur in the domain (CH2) and surrounding the hinge-1 region. The four autosomal dominant disorders that are associated with FLNB variants are Larsen syndrome, atelosteogenesis type I (AOI), atelosteogenesis type III (AOIII), and boomerang dysplasia (BD). Despite the intense clustering of FLNB variants contributing to the LS-AO-BD disorders, the genotype-phenotype correlation is still enigmatic. In silico prediction tools and molecular dynamics simulation (MDS) approaches have offered the potential for variant classification and pathogenicity predictions. We retrieved 285 FLNB missense variants from the UniProt, ClinVar, and HGMD databases in the current study. Of these, five and 39 variants were located in the CH1 and CH2 domains, respectively. These variants were subjected to various pathogenicity and stability prediction tools, evolutionary and conservation analyses, and biophysical and physicochemical properties analyses. Molecular dynamics simulation (MDS) was performed on the three candidate variants in the CH2 domain (W148R, F161C, and L171R) that were predicted to be the most pathogenic. The MDS analysis results showed that these three variants are highly compact compared to the native protein, suggesting that they could affect the protein on the structural and functional levels. The computational approach demonstrates the differences between the FLNB mutants and the wild type in a structural and functional context. Our findings expand our knowledge on the genotype-phenotype correlation in FLNB-related LS-AO-BD disorders on the molecular level, which may pave the way for optimizing drug therapy by integrating precision medicine.
Assuntos
Proteínas de Ligação ao Cálcio/química , Filaminas/química , Proteínas dos Microfilamentos/química , Modelos Moleculares , Domínios Proteicos , Fenômenos Químicos , Nanismo/etiologia , Evolução Molecular , Fácies , Filaminas/genética , Filaminas/metabolismo , Variação Genética , Humanos , Simulação de Dinâmica Molecular , Mutação , Osteocondrodisplasias/etiologia , Polimorfismo de Nucleotídeo Único , Conformação Proteica , Solventes/química , Relação Estrutura-Atividade , CalponinasRESUMO
OBJECTIVE: To describe the etiology of severe short stature in the Helsinki University Hospital district covering a population of 1.2 million that is subject to frequent growth monitoring and screening rules during childhood. DESIGN: Retrospective cohort study. METHODS: We identified all subjects born 1990 or later with a height SD score <-3, after the age of 3 years, from the Helsinki University Hospital district growth database. A total of 785 subjects (376 females and 409 males) fulfilled our inclusion criteria; we reviewed their medical records and growth data and report their underlying diagnoses. RESULTS: A pathological cause for short stature was diagnosed in 76% of the girls and 71% of the boys (P = NS). Syndromes were the most numerous pathological cause (n = 160; 20%), followed by organ disorders (n = 127; 16%), growth hormone deficiency (GHD, n = 94; 12%), SGA without catch-up growth (n = 73; 9%), and skeletal dysplasias (n = 57; 7%). Idiopathic short stature (ISS) was diagnosed in 210 (27%) subjects. The probability of growth-related pathology, particularly of a syndrome or skeletal dysplasia, increased with the shorter height SD score and the greater deviation from the target height. Sitting height to height SDS was increased in subjects with ISS, GHD, and SGA (all P < 0.01). CONCLUSIONS: Height <-3 SDS after 3 years of age usually results from a pathological cause and should be thoroughly investigated in specialized health care. The chance of finding a specific etiology increased with the severity of short stature, and the mismatch with target height.
Assuntos
Nanismo/etiologia , Transtornos do Crescimento/etiologia , Adolescente , Estatura , Criança , Pré-Escolar , Bases de Dados Factuais , Nanismo/epidemiologia , Feminino , Finlândia/epidemiologia , Gráficos de Crescimento , Transtornos do Crescimento/epidemiologia , Humanos , Masculino , Estudos Retrospectivos , SíndromeRESUMO
OBJECTIVE: 3-M syndrome is characterized by severe short stature, syndromic features, and characteristic radiographic findings. Growth hormone (GH) has been used with variable success. Recombinant human insulin like growth factor-1 (rhIGF-1) has never been utilized. CASE PRESENTATION: We describe a child with severe growth retardation, macrocephaly, and skeletal abnormalities with evidence of GH insensitivity subsequently treated with rhIGF-1. He developed morbid obesity and comorbidities including voracious appetite, acanthosis nigricans, tonsillar hypertrophy, and severe obstructive sleep apnea with minimal height improvement. Genetic testing done at 11.5 years revealed a compound heterozygous mutation (c.2112G>A(p.W704X) and c.2559delC) in the CUL7 gene consistent with 3-M syndrome-1. rhIGF-1 therapy was discontinued. CONCLUSIONS: This case highlights the novel use of rhIGF-1 therapy on a child with 3-M syndrome-1 with minimal height benefit but accelerated weight gain and serves as a reminder of the importance of re-evaluating therapy efficacy and side effect profile.
Assuntos
Proteínas Culina/genética , Nanismo/tratamento farmacológico , Substâncias de Crescimento/uso terapêutico , Fator de Crescimento Insulin-Like I/uso terapêutico , Hipotonia Muscular/tratamento farmacológico , Mutação , Proteínas Recombinantes/uso terapêutico , Coluna Vertebral/anormalidades , Pré-Escolar , Nanismo/etiologia , Nanismo/patologia , Humanos , Masculino , Hipotonia Muscular/etiologia , Hipotonia Muscular/patologia , Prognóstico , Coluna Vertebral/patologiaRESUMO
We report on a 26-year-old male with extreme short stature, microcephaly, macroglossia, other dysmorphic features, severe intellectual disability, and a bone dysplasia. The patient had an extensive genetic and biochemical evaluation that was all normal or noninformative. Recently, the proband died following a period of not eating. He likely had a previously undescribed syndrome of unknown etiology.
Assuntos
Anormalidades Múltiplas/etiologia , Doenças do Desenvolvimento Ósseo/etiologia , Nanismo/etiologia , Adulto , Doenças do Desenvolvimento Ósseo/diagnóstico por imagem , Face/anormalidades , Feminino , Retardo do Crescimento Fetal , Humanos , Recém-Nascido , Deficiência Intelectual , Masculino , Microcefalia/etiologia , Gravidez , SíndromeRESUMO
Objectives Small for gestational age (SGA) status is known to show stunted growth and results in short stature in adults. The aim of this study was to describe the current short stature in subjects born SGA in Korea and to assess catch-up growth (CUG) or non-CUG. Methods We analyzed data from 3,524 subjects (1,831 male) aged 1-18 years who were born as full-term singletons and who participated in the Fifth Korean National Health and Nutrition Examination Survey (2010-2011). Results The prevalence of SGA was 13.4% (n=471). Subjects born SGA had fathers with shorter height, shorter mother's height, and mid-parental height than non-SGA subjects (p<0.05 for all). The odds ratios (ORs) for SGA birth of a short statured father and a short statured mother were 2.00 (95% CI; 1.15-3.47) and 2.11 (95% CI; 1.30-3.40), respectively. Among 471 SGA subjects, 28 subjects (5.9%) were non-CUG, which made up 36.4% of all subjects with short stature. The CUG subjects had a higher father's height, mother's height, mid-parental height, and current BMI (p<0.05 for all). The non-CUG subjects had a higher percentage of fathers being near-short stature (height<10th percentile; 33.3 vs. 12.7%; p=0.008) and mothers being near-short stature (39.3 vs. 13.9%; p<0.001). Conclusion Korean subjects born SGA had a higher risk of current short stature. This population-based nationwide survey also showed that both father's and mother's short stature are risk factors of not only SGA birth but also non-CUG in their children.
Assuntos
Desenvolvimento Infantil/fisiologia , Recém-Nascido Pequeno para a Idade Gestacional/crescimento & desenvolvimento , Adolescente , Criança , Pré-Escolar , Nanismo/epidemiologia , Nanismo/etiologia , Feminino , Idade Gestacional , Transtornos do Crescimento/epidemiologia , Transtornos do Crescimento/etiologia , Humanos , Lactente , Masculino , Inquéritos Nutricionais , República da Coreia/epidemiologia , Fatores de RiscoRESUMO
BACKGROUND: Children with chronic kidney disease (CKD) have delays in normal growth and pubertal development. We describe factors associated with delayed menarche and the association of delayed menarche with short stature in girls with CKD. METHODS: Two hundred eighty-seven girls with CKD onset prior to menarche within the Chronic Kidney Disease in Children (CKiD) cohort were studied. Delayed menarche was defined as menarche at age 15 years or older; short stature was defined as last available height 2 standard deviations below projected adult height. Kaplan-Meier cumulative incidence function was used to estimate median age at menarche. Chi-squared and Wilcoxon rank-sum tests were used to assess factors associated with delayed menarche. Chi-squared test was used to evaluate the association between delayed menarche and short stature. RESULTS: Among 287 girls, 68 enrolled with prevalent menarche, 131 were observed to have incident menarche, and 88 were pre-menarchal at their last study visit. Median age at menarche was 12 years. Ten percent had delayed menarche. African American race, lower estimated glomerular filtration rate, ever corticosteroid use, and longer CKD duration were associated with delayed menarche (p < 0.05). Girls with delayed menarche had lower height and weight percentiles at the time of menarche (p < 0.05). Sixty-one percent of girls with delayed menarche had short stature compared with only 35% of girls without delayed menarche (p = 0.03). CONCLUSION: Median age at menarche is similar among girls with CKD and healthy girls. Ten percent of girls with CKD had delayed menarche and may be at risk for short stature.
Assuntos
Menarca , Insuficiência Renal Crônica/complicações , Adolescente , Fatores Etários , Estatura , Criança , Nanismo/etiologia , Feminino , Taxa de Filtração Glomerular , Humanos , Estudos ProspectivosRESUMO
BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.
Assuntos
Proteínas Culina/genética , Nanismo/genética , Hipotonia Muscular/genética , Coluna Vertebral/anormalidades , Povo Asiático/genética , Criança , Simulação por Computador , Nanismo/etiologia , Feminino , Mutação da Fase de Leitura , Homozigoto , Humanos , Lactente , Masculino , Hipotonia Muscular/etiologia , Mutação de Sentido Incorreto , Linhagem , Gravidez , Sequenciamento do ExomaRESUMO
BACKGROUND: Thiamine-responsive megaloblastic anemia (TRMA) is a rare autosomal recessive inherited disease characterized by the clinical triad of megaloblastic anemia, sensorineural deafness, and diabetes mellitus. To date, only 100 cases of TRMA have been reported in the world. CASE PRESENTATION: Here, we describe a six-year-old boy with diabetes mellitus, anemia, and deafness. Additionally, he presented with thrombocytopenia, leukopenia, horizontal nystagmus, hepatomegaly, short stature, ventricular premature beat (VPB), and cerebral infarction. DNA sequencing revealed a novel compound heterozygous mutation in the SLC19A2 gene: (1) a duplication c.405dupA, p.Ala136Serfs*3 (heterozygous) and (2) a nucleotide deletion c.903delG p.Trp301Cysfs*13 (heterozygous). The patient was diagnosed with a typical TRMA. CONCLUSION: Novel mutations in the SLC19A2 gene have been identified, expanding the mutation spectrum of the SLC19A2 gene. For the first time, VPB and cerebral infarction have been identified in patients with TRMA syndrome, providing a new understanding of the phenotype.
Assuntos
Anemia Megaloblástica/genética , Infarto Cerebral/etiologia , Diabetes Mellitus/genética , Perda Auditiva Neurossensorial/genética , Proteínas de Membrana Transportadoras/genética , Deficiência de Tiamina/congênito , Adulto , Anemia Megaloblástica/tratamento farmacológico , Anemia Megaloblástica/patologia , Arritmias Cardíacas/etiologia , Atrofia , Encéfalo/patologia , Criança , Análise Mutacional de DNA , Diabetes Mellitus/tratamento farmacológico , Diabetes Mellitus/patologia , Diabetes Mellitus Tipo 1/etiologia , Nanismo/etiologia , Feminino , Perda Auditiva Bilateral/etiologia , Perda Auditiva Neurossensorial/tratamento farmacológico , Perda Auditiva Neurossensorial/patologia , Heterozigoto , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Fenótipo , Tiamina/uso terapêutico , Deficiência de Tiamina/tratamento farmacológico , Deficiência de Tiamina/genética , Deficiência de Tiamina/patologia , Complexos Ventriculares Prematuros/etiologiaRESUMO
Background Hutchinson-Gilford progeria syndrome (HGPS) is a rare disease caused by pathogenic variants in the LMNA gene, which leads to premature aging. The median life expectancy is shortened to 13 years due to cardiovascular complications. Case report We present a boy born with a pathogenic LMNA variant c.433G > A, which causes atypical progeria syndrome (APS) and was previously described in one single patient. When investigated for poor growth prior to the diagnosis of APS, his laboratory tests revealed growth hormone (GH) deficiency and magnetic resonance imaging (MRI) of the midbrain showed partial empty sella. GH treatment had only a limited and transient effect. His first ischemic complication manifested at age 4.2 years; at the age of 7 years, he had a fatal haemorrhagic stroke. Conclusion To the best of our knowledge, this is the first patient with APS showing partial empty sella and GH deficiency that might have contributed to his poor growth. GH failed to improve long-term outcome.
Assuntos
Nanismo/etiologia , Hormônio do Crescimento Humano/deficiência , Lamina Tipo A/genética , Mutação , Progéria/complicações , Pré-Escolar , Nanismo/tratamento farmacológico , Evolução Fatal , Hormônio do Crescimento Humano/administração & dosagem , Humanos , Lactente , Masculino , Progéria/genética , Progéria/patologiaRESUMO
Juvenile idiopathic arthritis (JIA) is a chronic systemic inflammatory disease, which affects children and adolescents, characterized by significant differences when compared to inflammatory rheumatisms in adulthood. Today, in a panorama enriched in the last decades with great improvements in the diagnostic and therapeutic field, a far from negligible portion and an increasing number of patients with JIA require the continuation of treatments in adulthood. This specific population of patients, given the high incidence of extra-articular manifestations, residual irreversible disabilities, comorbidities related to an inflammatory process and extended immunosuppressive treatments during the age of development, requires precise attentions in the follow-up and a multidisciplinary approach characterized by different clinical, psychological and social aspects.
Assuntos
Artrite Juvenil/diagnóstico , Adolescente , Amiloidose/etiologia , Artrite Juvenil/complicações , Artrite Juvenil/terapia , Criança , Pré-Escolar , Progressão da Doença , Nanismo/etiologia , Oftalmopatias/etiologia , Humanos , Osteoporose/etiologia , Índice de Gravidade de Doença , Transição para Assistência do AdultoRESUMO
We assessed anthropometry in 22,421 adult daughters in association with their mothers' tobacco smoking early in pregnancy (at their first antenatal visit) in Sweden, particularly their risk of short stature and obesity. Adult daughters were grouped by maternal smoking levels during pregnancy: Non-smokers (58.5%), Light smokers (24.1%; smoked 1-9 cigarettes/day), and Heavier smokers (17.4%; smoked ≥10 cigarettes/day). Anthropometry was recorded on the adult daughters at approximately 26.0 years of age. Obesity was defined as BMI ≥30 kg/m2, and short stature as height more than two standard deviations below the population mean. Daughters whose mothers were Light and Heavier smokers in early pregnancy were 0.8 cm and 1.0 cm shorter, 2.3 kg and 2.6 kg heavier, and had BMI 0.84 kg/m2 and 1.15 kg/m2 greater, respectively, than daughters of Non-smokers. The adjusted relative risk of short stature was 55% higher in women born to smokers, irrespectively of smoking levels. Maternal smoking had a dose-dependent association with obesity risk, with offspring of Heavier smokers 61% and of Light smokers 37% more likely to be obese than the daughters of Non-smokers. In conclusion, maternal smoking in pregnancy was associated with an increased risk of short stature and obesity in their adult daughters.
Assuntos
Peso ao Nascer/fisiologia , Nanismo/etiologia , Obesidade/etiologia , Fumar/efeitos adversos , Filhos Adultos , Antropometria , Nanismo/epidemiologia , Feminino , Humanos , Mães , Núcleo Familiar , Obesidade/epidemiologia , Gravidez , Efeitos Tardios da Exposição Pré-Natal , Fatores de Risco , SuéciaRESUMO
OBJECTIVE: There is limited information on the psychosocial impact of growing up with Silver-Russell syndrome (SRS), characterised by slow growth in utero leading to short stature in adulthood. Such information could aid families in making difficult treatment decisions and guide management strategies for health professionals. We aimed to explore the lived experience of people with SRS across the lifespan. DESIGN/SETTING/PATIENTS: In-depth, semi-structured interviews were conducted between January 2015 and October 2016 with a sample of 15 adults (six women) with genetically confirmed SRS from the UK. Qualitative interviews were transcribed and coded to identify similarities and differences: codes were then grouped to form overarching themes. RESULTS: Four themes were identified from participant accounts: (1) appearance-related concerns extending beyond height; (2) strategies to deal with real and perceived threats; (3) women's experiences of pain, disability and feeling older than their years; and (4) feeling overlooked in romantic relationships. These themes show that other factors, beyond short stature, affect patient well-being and indicate a mismatch between patient need and healthcare provision. CONCLUSIONS: Challenges in SRS during childhood and adolescence were central to the psychosocial impact of SRS, and were not limited to height. These challenges, as well as symptoms such as pain and fatigue for women, have not previously been documented. To help individuals with SRS develop strategies to manage psychosocial issues, we recommend clinicians incorporate psychological services as an integral part of multidisciplinary teams managing individuals with SRS during childhood, adolescence and adulthood.
Assuntos
Adaptação Psicológica/fisiologia , Estatura , Nanismo , Dor , Síndrome de Silver-Russell , Adulto , Criança , Avaliação da Deficiência , Nanismo/etiologia , Nanismo/fisiopatologia , Nanismo/psicologia , Fadiga/diagnóstico , Fadiga/etiologia , Feminino , Humanos , Masculino , Avaliação das Necessidades , Dor/diagnóstico , Dor/etiologia , Psicologia , Fatores Sexuais , Síndrome de Silver-Russell/diagnóstico , Síndrome de Silver-Russell/epidemiologia , Síndrome de Silver-Russell/fisiopatologia , Síndrome de Silver-Russell/psicologia , Reino Unido/epidemiologiaRESUMO
Mutations in the a disintegrin and metalloproteinase with thrombospondin motif-like 2 ( ADAMTSL2) gene are responsible for the autosomal recessive form of geleophysic dysplasia, which is characterized by short stature, short extremities, and skeletal abnormalities. However, the exact function of ADAMTSL2 is unknown. To elucidate the role of this protein in skeletal development, we generated complementary knockout (KO) mouse models with either total or chondrocyte Adamtsl2 deficiency. We observed that the Adamtsl2 KO mice displayed skeletal abnormalities reminiscent of the human phenotype. Adamtsl2 deletion affected the growth plate formation with abnormal differentiation and proliferation of chondrocytes. In addition, a TGF-ß signaling impairment in limbs lacking Adamtsl2 was demonstrated. Further investigations revealed that Adamtsl2 KO chondrocytes failed to establish a microfibrillar network composed by fibrillin1 and latent TGF-ß binding protein 1 fibrils. Chondrocyte Adamtsl2 KO mice also exhibited dwarfism. These studies uncover the function of Adamtsl2 in the maintenance of the growth plate ECM by modulating the microfibrillar network.-Delhon, L., Mahaut, C., Goudin, N., Gaudas, E., Piquand, K., Le Goff, W., Cormier-Daire, V., Le Goff, C. Impairment of chondrogenesis and microfibrillar network in Adamtsl2 deficiency.
Assuntos
Proteínas ADAMTS/fisiologia , Doenças do Desenvolvimento Ósseo/etiologia , Condrogênese , Nanismo/etiologia , Proteínas da Matriz Extracelular/fisiologia , Microfibrilas/patologia , Animais , Doenças do Desenvolvimento Ósseo/metabolismo , Doenças do Desenvolvimento Ósseo/patologia , Nanismo/metabolismo , Nanismo/patologia , Heterozigoto , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Microfibrilas/metabolismo , Mutação , Fenótipo , Fator de Crescimento Transformador beta/metabolismoRESUMO
Turner syndrome is a chromosomal aberration linked to the complete or partial absence of an X chromosome. Its prevalence is 1/2500 female newborns. We report a case in the department of internal medicine and endocrinology of the hospital of MALI. This was a 14-year old girl who consulted for stunting and puberty. She presented clinically a dysmorphic syndrome, TANNER stage1 secondary sexual characteristics, weight and height at -3 DS and a bone age estimated to 9½ years old on the X-ray of the hand. The hormonal assessment showed an elevation of FSH and LH and the genetic study showed an iso chromosome Xq. This result was part of a Turner syndrome with Xq iso chromosome.
Le syndrome de Turner est une aberration chromosomique liée à l'absence complète ou partielle d'un chromosome X. Sa prévalence est de 1/2500 nouveaux nés de sexe féminin. Nous rapportons un cas dans le service de médecine interne et d'endocrinologie de l'hôpital du MALI. Il s'agissait d'une fille de 14 ans, qui a consulté pour retard de croissance et de puberté. Elle présentait cliniquement un syndrome dysmorphique, les caractères sexuels secondaires au stade1 de TANNER, le poids et la taille à −3 DS et un âge osseux estimé à 9 ans et demi à la radiographie de la main. Le bilan hormonal montrait une élévation de la FSH et la LH et l'étude génétique montrait un iso chromosome Xq. Ce résultat entrait dans le cadre d'un syndrome de Turner avec iso chromosome Xq.
Assuntos
Puberdade Tardia/etiologia , Síndrome de Turner/diagnóstico , Adolescente , Determinação da Idade pelo Esqueleto , Cromossomos Humanos X/ultraestrutura , Nanismo/etiologia , Feminino , Humanos , Isocromossomos , Cariotipagem , Mali/epidemiologia , Fenótipo , Prevalência , Síndrome de Turner/complicações , Síndrome de Turner/epidemiologia , Síndrome de Turner/genéticaRESUMO
Expression of HMGA2 is strongly associated with body size and growth in mice and humans. In mice, inactivation of one or both alleles of Hmga2 results in body-size reductions of 20% and 60%, respectively. In humans, microdeletions involving the HMGA2 locus result in short stature, suggesting the function of the HMGA2 protein is conserved among mammals. To test this hypothesis, we generated HMGA2-deficient pigs via gene editing and somatic cell nuclear transfer (SCNT). Examination of growth parameters revealed that HMGA2-/+ male and female pigs were on average 20% lighter and smaller than HMGA2+/+ matched controls (P < 0.05). HMGA2-/- boars showed significant size reduction ranging from 35 to 85% of controls depending on age (P < 0.05), and organ weights were also affected (P < 0.05). HMGA2-/+ gilts and boars exhibited normal reproductive development and fertility, while HMGA2-/- boars were sterile due to undescended testes (cryptorchidism). Crossbreeding HMGA2-/+ boars and gilts produced litters lacking the HMGA2-/- genotype. However, analysis of day (D) D40 and D78 pregnancies indicated that HMGA2-/- fetuses were present at the expected Mendelian ratio, but placental abnormalities were seen in the D78 HMGA2-/- concepti. Additionally, HMGA2-/- embryos generated by gene editing and SCNT produced multiple pregnancies and viable offspring, indicating that lack of HMGA2 is not lethal per se. Overall, our results show that the effect of HMGA2 with respect to growth regulation is highly conserved among mammals and opens up the possibility of regulating body and organ size in a variety of mammalian species including food and companion animals.
Assuntos
Criptorquidismo/etiologia , Nanismo/etiologia , Doenças Fetais/etiologia , Proteína HMGA2/deficiência , Doenças dos Suínos/etiologia , Animais , Criptorquidismo/patologia , Nanismo/patologia , Feminino , Doenças Fetais/patologia , Genótipo , Proteína HMGA2/genética , Tamanho da Ninhada de Vivíparos , Masculino , Técnicas de Transferência Nuclear/veterinária , Gravidez , Reprodução , Suínos , Doenças dos Suínos/patologiaAssuntos
Estatura , Nanismo/epidemiologia , Adolescente , Adulto , Criança , Nanismo/tratamento farmacológico , Nanismo/etiologia , Feminino , Hormônio do Crescimento Humano/uso terapêutico , Humanos , Hipopituitarismo/epidemiologia , Hipopituitarismo/etiologia , Masculino , Proteínas Recombinantes/uso terapêutico , África do Sul/epidemiologia , Adulto JovemRESUMO
Mucopolysaccharidoses (MPS) are a group of lysosomal storage disorders that affect regulation of glycosaminoglycan (GAG) processing. In MPS, the lysosomes cannot efficiently break down GAGs, and the specific GAGs accumulated depend on the type of MPS. The level of impairment of breakdown varies between patients, making this one of the many factors that lead to a range of clinical presentations even in the same type of MPS. These clinical presentations usually involve skeletal dysplasia, in which the most common feature is bone growth impairment and successive short stature. Growth impairment occurs due to the deposition and retention of GAGs in bone and cartilage. The accumulation of GAGs in these tissues leads to progressive damage in cartilage that in turn reduces bone growth by destruction of the growth plate, incomplete ossification, and imbalance of growth. Imbalance of growth leads to various skeletal abnormalities including disproportionate dwarfism with short neck and trunk, prominent forehead, rigidity of joints, tracheal obstruction, kyphoscoliosis, pectus carinatum, platyspondyly, round-shaped vertebral bodies or beaking sign, underdeveloped acetabula, wide flared iliac, coxa valgus, flattered capital femoral epiphyses, and genu valgum. If left untreated, skeletal abnormalities including growth impairment result in a significant impact on these patients' quality of life and activity of daily living, leading to high morbidity and severe handicap. This review focuses on growth impairment in untreated patients with MPS. We comprehensively describe the growth abnormalities through height, weight, growth velocity, and BMI in each type of MPS and compare the status of growth with healthy age-matched controls. The timing, the degree, and the difference in growth impairment of each MPS are highlighted to understand the natural course of growth and to evaluate future therapeutic efficacy.