The first high-quality chromosome-level genome assembly of Phyllanthaceae (Phyllanthus cochinchinensis) provides insights into flavonoid biosynthesis.

MAIN CONCLUSION: We report the genome assembly of P. cochinchinensis, as the first high-quality chromosome-level genome of Phyllanthaceae which is rich in medicinal plants. Phyllanthus cochinchinensis, a member of the Phyllanthaceae, is one of the famous medicinal plants in South China. Here, we report a de novo chromosome-level genome assembly for P. cochinchinensis using a combination of Nanopore and Illumina sequencing technologies. In total, the assembled genome consists of 284.88 Mb genomic sequences with a contig N50 of 10.32 Mb, representing ~ 95.49% of the estimated genome size. By applying Hi-C data, 13 pseudochromosomes of P. cochinchinensis were constructed, covering ~ 99.87% of the assembled sequences. The genome is annotated with 59.12% repetitive sequences and 20,836 protein-coding genes. Whole-genome duplication of P. cochinchinensis is likely shared with Ricinus communis as well as Vitis vinifera. Homologous genes within the flavonoid pathway for P. cochinchinensis were identified and copy numbers and expression level of related genes revealed potential critical genes involved in flavonoid biosynthesis. This study provides the first whole-genome sequence for the Phyllanthaceae, confirms the evolutionary status of Phyllanthus from the genomic level, and provides foundations for accelerating functional genomic research of species from Phyllanthus.

Bar-cas12a, a novel and rapid method for plant species authentication in case of Phyllanthus amarus Schumach. & Thonn.

Rapid and accurate species diagnosis accelerates performance in numerous biological fields and associated areas. However, morphology-based species taxonomy/identification might hinder study and lead to ambiguous results. DNA barcodes (Bar) has been employed extensively for plant species identification. Recently, CRISPR-cas system can be applied for diagnostic tool to detect pathogen's DNA based on the collateral activity of cas12a or cas13. Here, we developed barcode-coupled with cas12a assay, "Bar-cas12a" for species authentication using Phyllanthus amarus as a model. The gRNAs were designed from trnL region, namely gRNA-A and gRNA-B. As a result, gRNA-A was highly specific to P. amarus amplified by RPA in contrast to gRNA-B even in contaminated condition. Apart from the large variation of gRNA-A binding in DNA target, cas12a- specific PAM's gRNA-A as TTTN can be found only in P. amarus. PAM site may be recognized one of the potential regions for increasing specificity to authenticate species. In addition, the sensitivity of Bar-cas12a using both gRNAs gave the same detection limit at 0.8 fg and it was 1,000 times more sensitive compared to agarose gel electrophoresis. This approach displayed the accuracy degree of 90% for species authentication. Overall, Bar-cas12a using trnL-designed gRNA offer a highly specific, sensitive, speed, and simple approach for plant species authentication. Therefore, the current method serves as a promising tool for species determination which is likely to be implemented for onsite testing.

DNA Barcoding for the Identification of Phyllanthus Taxa Used Medicinally in Brazil.

Plants of the genus Phyllanthus, principally Phyllanthus amarus, Phyllanthus urinaria, Phyllanthus niruri, and Phyllanthus tenellus, are used in Brazilian folk medicine to treat kidney stones as well as other ailments, where the latter two species are listed in the Brazilian Pharmacopeia as quebra-pedra (stone-breaker). However, only P. niruri has been shown to be effective in a clinical setting. Nuclear ribosomal internal transcribed spacer (ITS1 - 5.8S rRNA-ITS2), internal transcribed spacer 2, and chloroplasts rbcL, matK, psbA-trnH, trnL, and trnL-trnF were screened for their potential as DNA barcodes for the identification of 48 Phyllanthus taxa in Brazilian medicinal plant germplasm banks and in "living pharmacies". The markers were also tested for their ability to validate four commercial herbal teas labelled as quebra-pedra. Using the criterion of high clade posterior probability in Bayesian phylogenetic analysis, the internal transcribed spacer, internal transcribed spacer 2, and chloroplast matK, psbA-trnH, trnL, and trnL-trnF markers all reliably differentiated the four Phyllanthus species, with the internal transcribed spacer and matK possessing the additional advantage that the genus is well represented for these markers in the Genbank database. However, in the case of rbcL, posterior probability for some clades was low and while P. amarus and P. tenellus formed monophyletic groups, P. niruri and P. urinaria accessions could not be reliably distinguished with this marker. Packaged dried quebra-pedra herb from three Brazilian commercial suppliers comprised P. tenellus, but one sample was also found to be mixed with alfalfa (Medicago sativa). An herb marketed as quebra-pedra from a fourth supplier was found to be composed of a mixture of Desmodium barbatum and P. niruri.

Authenticity analyses of Phyllanthus amarus using barcoding coupled with HRM analysis to control its quality for medicinal plant product.

The Phyllanthus genus, a plant used in traditional Thai medicine, has according to several pharmacopeias hepatoprotective properties. Not only is the anatomical morphology of these species relatively similar but they also share the Thai common names Look-Tai-Bai (ลูกใต้ใบ) and Yah-Tai-Bai (หญ้าใต้ใบ), which might cause confusion for laypersons. This study attempted to develop a method for accurate identification of Phyllanthus species, especially Phyllanthus amarus, and to detect contaminants in P. amarus products by using DNA barcoding coupled with high resolution melting (HRM) analysis (bar-HRM). Two plastid loci (rbcL and trnL) were chosen for DNA barcoding to generate a suitable primer for distinguishing Phyllanthus species by HRM analysis. The five species of Phyllanthus were subjected to amplification for testing the specificity and discrimination power of the designed primers derived from rbcL and trnL regions. Sensitivity of the method (DNA barcoding conjugated with HRM) to detect adulterant in P. amarus samples was evaluated. The commercial P. amarus products obtained from a local market were authenticated. The primer pair derived from trnL DNA barcoding (PhylltrnL) had more specificity and power of discrimination for Phyllanthus species than that derived from rbcL DNA barcoding (PhyllrbcL). The result showed that Tm of P. amarus, Phyllanthus urinaria, Phyllanthus debilis, Phyllanthus airy-shawii, and Phyllanthus virgatus was 74.3±0.08, 73.04±0.07, 73.36±0.05, 72.21±0.06, 72.77±0.15°C, respectively. This method proved to be a very sensitive tool that can be used for rapid detection of contamination as low as 1% of other Phyllanthus species in P. amarus admixtures. All commercial products of P. amarus obtained from a local market in Thailand were found to contain pure raw materials of P. amarus without any substitution or contamination. Our results indicated that the use of DNA barcoding coupled with HRM was an efficient molecular tool for correct species identification. This molecular tool provides a noteworthy benefit for quality control of medicinal plants and industry plants for pharmacological prospects.

Ex situ conservation of Phyllanthus fraternus Webster and evaluation of genetic fidelity in regenerates using DNA-based molecular marker.

Germplasm storage of Phyllanthus fraternus by using synseed technology has been optimized. Synseeds were prepared from nodal segments taken from in vitro-grown plantlets. An encapsulation matrix of 3 % sodium alginate and 100 mM calcium chloride with polymerization duration up to 15 min was found most suitable for synseed formation. Maximum plantlet conversion (92.5 ± 2.5 %) was obtained on a growth regulator-free ½-strength solid Murashige and Skoog (MS) medium. Multiple shoot proliferation was optimum on a ½ MS medium containing 0.5 mg/l 6-benzylaminopurine (BAP). Shoots were subjected to rooting on MS media containing 1 mg/l α-naphthaleneacetic acid (NAA) and acclimatized successfully. Encapsulated nodal segments can be stored for up to 90 days with a survival frequency of 47.33 %. The clonal fidelity of synseed-derived plantlets was also assessed and compared with that of the mother plant using rapid amplified polymorphic DNA and inter-simple sequence repeat analysis. No changes in molecular profiles were observed among the synseed-derived plantlets and mother plant, which confirms the genetic stability of regenerates. This synseed production protocol could be useful for in vitro multiplication, short-term storage, and exchange of germplasm of this important antiviral and hepatoprotective plant.

An overview of important ethnomedicinal herbs of Phyllanthus species: present status and future prospects.

The genus Phyllanthus consists of more than 1000 species, of which many are used as traditional medicines. The plant extracts have been used since ancient times, for treating hypertension, diabetes, hepatic, urinary, and sexual disorders, and other common ailments. Modern day scientific investigations have now confirmed pharmacognostic properties of Phyllanthus herbs. The phytochemicals attributing these medicinal properties have been identified in many of the Phyllanthus herbs. The morphologically similar herbs of Phyllanthus grow together and admixture of species during collection for manufacture of herbal medicines is quite common. Hence, along with pharmacognostic and phytochemical studies, appropriate protocols for correct identification of species are also important. As the use of these herbs as green medicines is becoming more popular, it is imperative to assess its genetic diversity and phylogenetic relatedness for future conservation strategies. This review is an attempt to present an overview of the existing studies on pharmacognostics, phytochemistry, species identification, and genetic diversity of Phyllanthus herbs and consequently (i) highlight areas where further research is needed and (ii) draw attention towards extending similar studies in underutilized but potentially important herbs such as P. maderaspatensis, P. kozhikodianus, P. rheedii, P. scabrifolius, and P. rotundifolius.

Identification of species-diagnostic inter simple sequence repeat markers for ten Phyllanthus species.

Phyllanthus has been widely used in traditional medicine as an antipyretic, a diuretic, and to treat liver diseases and viral infections. Correct genotype identification of medicinal plant material remains important for the botanical drug industry. Limitations of chemical and morphological approaches for authentication have generated the need for newer methods in quality control of botanicals. In the present study, attempts were made to identify species-diagnostic markers for ten Phyllanthus species using the inter simple sequence repeat-polymerase chain reaction (ISSR-PCR) fingerprinting method. PCR amplification using seven ISSR primers resulted in significant polymorphism among the populations from different species. P. angustifolius and P. urinaria showed monomorphic frequency of maximum (63.88%) and minimum (20.64%), respectively. Seventeen species-diagnostic markers were identified for seven species (P. acidus, P. emblica, P. fraternus, P. urinaria, P. rotundifolius, P. amarus, and P. angustifolius) while no marker was detected for P. reticulatus, P. nivosus, and P. virgulatus. A maximum of six species-diagnostic markers were identified for P. acidus and a minimum of only one of 755 bp was available for P. amarus. Among the seventeen markers, nine were present in all individuals of particular species. The species-specific differences in fragment numbers and sizes could be used as diagnostic markers to distinguish the Phyllanthus species quickly.

Gelechiidae moths are capable of chemically dissolving the pollen of their host plants: first documented sporopollenin breakdown by an animal.

BACKGROUND: Many insects feed on pollen surface lipids and contents accessible through the germination pores. Pollen walls, however, are not broken down because they consist of sporopollenin and are highly resistant to physical and enzymatic damage. Here we report that certain Microlepidoptera chemically dissolve pollen grains with exudates from their mouthparts. METHODOLOGY/PRINCIPAL FINDINGS: Field observations and experiments in tropical China revealed that two species of Deltophora (Gelechioidea) are the exclusive pollinators of two species of Phyllanthus (Phyllanthaceae) on which their larvae develop and from which the adults take pollen and nectar. DNA sequences placed the moths and plants phylogenetically and confirmed that larvae were those of the pollinating moths; molecular clock dating suggests that the moth clade is younger than the plant clade. Captive moths with pollen on their mouthparts after 2-3 days of starvation no longer carried intact grains, and SEM photographs showed exine fragments on their proboscises. GC-MS revealed cis-ß-ocimene as the dominant volatile in leaves and flowers, but GC-MS analyses of proboscis extracts failed to reveal an obvious sporopollenin-dissolving compound. A candidate is ethanolamine, which occurs in insect hemolymphs and is used to dissolve sporopollenin by palynologists. CONCLUSIONS/SIGNIFICANCE: This is the first report of any insect and indeed any animal chemically dissolving pollen.

Molecular phylogenetic analysis of Phyllanthus species in Thailand and the application of polymerase chain reaction-restriction fragment length polymorphism for Phyllanthus amarus identification.

The genus Phyllanthus (Phyllanthaceae) is distributed in tropical and subtropical regions, and its members are widely used as medicinal plants in many countries. We analyzed the nucleotide sequences of the internal transcribed spacers of ribosomal DNA of 56 plant samples covering 23 Phyllanthus species collected from various habitats in Thailand. Based on the sequence alignment, we constructed phylogenetic trees of all Phyllanthus species distributed in Thailand. Furthermore, a simple protocol to discriminate three important medicinal Phyllanthus species, P. amarus, P. debilis, and P. urinaria, was developed using a Polymerase Chain Reaction-Restriction Fragment Length Polymorphism method and successfully applied to the crude drug samples obtained in Thai markets.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools.

ETHNOPHARMACOLOGICAL RELEVANCE: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. AIM OF THE STUDY: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. MATERIALS AND METHODS: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. RESULTS: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. CONCLUSION: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Delimitation of Sauropus (Phyllanthaceae) based on plastid matK and nuclear ribosomal ITS DNA Sequence data.

BACKGROUND AND AIMS: A recent molecular phylogenetic study showed that Sauropus is deeply embedded within Phyllanthus together with its allies, Breynia and Glochidion. As relationships within Sauropus are still problematic and the relationship with Breynia has long been doubted, more molecular data are needed to test/corroborate such a broad definition of Phyllanthus. This study aims to clarify the status and delimitation of Sauropus and establish its position within Phyllanthaceae. METHODS: Plastid matK and nuclear ribosomal ITS DNA sequence data for Sauropus and its allies were used to construct phylogenetic trees using maximum parsimony and Bayesian methods. KEY RESULTS: Within Phyllanthus, Sauropus can be split into the mainly south-east Asian Sauropus sensu stricto (s.s.) plus Breynia and the mainly Australian Sauropus (formerly Synostemon). Sauropus s.s. plus Breynia comprise two distinct clades; one is the combination of Sauropus sections Glochidioidei, Sauropus and Schizanthi and the other is the combination of Sauropus sections Cryptogynium and Hemisauropus and the monophyletic genus Breynia. CONCLUSIONS: Molecular data indicate that Synostemon should be reinstated at the same level as Sauropus s.s. and that Sauropus s.s. should be united with Breynia under the latter, older name. The molecular data corroborate only two of the five infrageneric groups of Sauropus recognized on the basis of morphological data.

SCAR markers for correct identification of Phyllanthus amarus, P. fraternus, P. debilis and P. urinaria used in scientific investigations and dry leaf bulk herb trade.

The trade in Phyllanthus material as bulk herb is rampant and mainly involves herbaceous species such as Phyllanthus amarus, P. fraternus, P . debilis and P. urinaria. These species are very important in herbal medicines and have varied activities. In India these species grow sympatrically and there are chances of deliberate or ignorant adulteration of crude drugs, lowering the efficiency of the medication for its intended purpose. Secondly, incorrect identification may also lead to erroneous reports on activities/molecules. To overcome this problem in crude drug (dry leaf powder) and compliment morphological identification in live plant, we have developed SCAR markers for all four species. In each species, we selected one fragment as being monomorphic between accessions but differing in size between species. These species-specific fragments were selected, cloned and sequenced. Based on the sequences, primer pairs were designed and amplification conditions standardized. SCAR markers were isolated from population DNA amplification profiles and validated by sequencing. The species-specific SCAR primers could retrieve the same size and sequence of fragments as in the RAPD profile. These fragments are 1150 bp, 317 bp, 980 bp and 550 bp in size for P. amarus, P. fraternus, P. debilis and P. urinaria, respectively. Additional fragments in P. debilis and P. urinaria indicate different alleles. The retrieval of same size and sequence of species-specific unique SCAR markers from the respective accessions (mixed DNA sample of same accessions) indicates the usefulness to study natural hybridization between the species in addition to adulteration.

Development and application of RAPD-SCAR marker for identification of Phyllanthus emblica LINN.

Correct genotype identification of medicinal plant material remains important for botanical drug industry. Limitations of chemical and morphological approaches for authentication have generated need for newer methods in quality control of botanicals. The present study was carried out to develop DNA based marker for identification of Phyllanthus emblica LINN. A putative marker (1.1 kb) specific for P. emblica was identified by Random Amplified Polymorphic DNA (RAPD) technique. Sequence Characterized Amplified Region (SCAR) marker was developed from the RAPD amplicon. The SCAR marker was found useful for identification of P. emblica in its commercial samples and Triphalachurna, a multi-component Ayurvedic formulation.

Phylogeny of medicinal Phyllanthus species in China based on nuclear ITS and chloroplast atpB-rbcL sequences and multiplex PCR detection assay analysis.

Plants of the genus Phyllanthus are commonly used in India, China and Korea for medicinal purposes. Although they are widely cultivated and marketed, there has been uncertainty about the efficacy of different species. A prerequisite of Good Agricultural Practice (GAP) is the authentication of relevant species, and this is now made unequivocal by applying DNA sequence tools. In this study the phylogenetic relationships among 18 Phyllanthus species found in China were investigated by DNA sequence analyses of the nuclear internal transcribed spacers (ITS1 and ITS2) along with the combined chloroplast ATPB and RBCL sequences. Cladistic analysis indicated that this genus is paraphyletic and strongly supports the notion that two problematic and confusing species, P. niruri and P. amarus, are two individual, albeit closely related, species. We have also developed an ITS rDNA-based multiplex PCR assay to differentiate three medicinally important species, P. amarus, P. niruri and P. urinaria.

Comparative pharmacognostic studies of three Phyllanthus species.

Different species of Phyllanthus are considered to be very effective hepatoprotective agents in the Indian indigenous systems of medicine and are considered bitter, astringent, stomachic, diuretic, febrifuge, deobstruant and antiseptic. Still ayurvedic practitioners prescribed fresh juice of 'Bhuiamlki' for jaundice. Various species of Phyllanthus are being sold in India under the trade name 'Bhuiamlki'. During market surveillance of herbal drug, it was observed that almost all the commercial samples, either comprise of Phyllanthus amarus Schum & Thonn. or Phyllanthus maderaspatensis Linn. or mixture of Phyllanthus amarus, Phyllanthus fraternus Webster. and Phyllanthus maderaspatensis. Therefore, in this context the detailed pharmacognostical evaluation of all the three species has been carried out with the aim to establish the identification markers of this important hepatoprotective agent (effective in hepatitis B too). The study conclude that all the three species can be differentiated on the basis of macro and microscopic characters, physico-chemical values, HPTLC fingerprint profile, and detection of phyllanthin and hypophyllanthin as marker components. Besides, an interesting conclusion can also be drawn that phyllanthin and hypophyllanthin said to protect hepatocytes against carbon tetrachloride and galactosamine induced toxicity, may not be exclusively responsible for hepatoprotective activity as these are present only in Phyllanthus amarus while Phyllanthus fraternus and Phyllanthus maderaspatensis also possess significant hepatoprotective activity.