Evidences for the action mechanism of angiotensin II and its analogs on Plasmodium sporozoite membranes.

Malaria is an infectious disease responsible for approximately one million deaths annually. Oligopeptides such as angiotensin II (AII) and its analogs are known to have antimalarial effects against Plasmodium gallinaceum and Plasmodium falciparum. However, their mechanism of action is still not fully understood at the molecular level. In the work reported here, we investigated this issue by comparing the antimalarial activity of AII with that of (i) its diastereomer formed by only d-amino acids; (ii) its isomer with reversed sequence; and (iii) its analogs restricted by lactam bridges, the so-called VC5 peptides. Data from fluorescence spectroscopy indicated that the antiplasmodial activities of both all-D-AII and all-D-VC5 were as high as those of the related peptides AII and VC5, respectively. In contrast, retro-AII had no significant effect against P. gallinaceum. Conformational analysis by circular dichroism suggested that AII and its active analogs usually adopted a ß-turn conformation in different solutions. In the presence of membrane-mimetic micelles, AII had also a ß-turn conformation, while retro-AII was random. Molecular dynamics simulations demonstrated that the AII chains were slightly more bent than retro-AII at the surface of a model membrane. At the hydrophobic membrane interior, however, the retro-AII chain was severely coiled and rigid. AII was much more flexible and able to experience both straight and coiled conformations. We took it as an indication of the stronger ability of AII to interact with membrane headgroups and promote pore formation.

De novo assembly and transcriptome analysis of Plasmodium gallinaceum identifies the Rh5 interacting protein (ripr), and reveals a lack of EBL and RH gene family diversification.

BACKGROUND: Malaria parasites that infect birds can have narrow or broad host-tropisms. These differences in host specificity make avian malaria a useful model for studying the evolution and transmission of parasite assemblages across geographic ranges. The molecular mechanisms involved in host-specificity and the biology of avian malaria parasites in general are important aspects of malaria pathogenesis that warrant further examination. Here, the transcriptome of the malaria parasite Plasmodium gallinaceum was characterized to investigate the biology and the conservation of genes across various malaria parasite species. METHODS: The P. gallinaceum transcriptome was annotated and KEGG pathway mapping was performed. The ripr gene and orthologous genes that play critical roles in the purine salvage pathway were identified and characterized using bioinformatics and phylogenetic methods. RESULTS: Analysis of the transcriptome sequence database identified essential genes of the purine salvage pathway in P. gallinaceum that shared high sequence similarity to Plasmodium falciparum when compared to other mammalian Plasmodium spp. However, based on the current sequence data, there was a lack of orthologous genes that belonged to the erythrocyte-binding-like (EBL) and reticulocyte-binding-like homologue (RH) family in P. gallinaceum. In addition, an orthologue of the Rh5 interacting protein (ripr) was identified. CONCLUSIONS: These findings suggest that the pathways involved in parasite red blood cell invasion are significantly different in avian Plasmodium parasites, but critical metabolic pathways are conserved throughout divergent Plasmodium taxa.

A new factor in the Aedes aegypti immune response: CLSP2 modulates melanization.

Microbial infections in the mosquito Aedes aegypti activate the newly identified CLSP1 and CLSP2 genes, which encode modular proteins composed of elastase-like serine protease and C-type lectin domains. These genes are predominantly regulated by the immune deficiency pathway, but also by the Toll pathway. Silencing of CLSP2, but not CLSP1, results in the activation of prophenoloxidase (PPO), the terminal enzyme in the melanization cascade, suggesting that CLSP2 is a negative modulator of this reaction. Haemolymph PPO activation is normally inhibited in the presence of Plasmodium parasites, but in CLSP2-depleted mosquitoes, the Plasmodium-induced block of melanization is reverted, and these mosquitoes are refractory to the parasite. Thus, CLSP2 is a new component of the mosquito immune response.

The major insect lipoprotein is a lipid source to mosquito stages of malaria parasite.

Once mosquito midgut barrier was crossed malaria parasite faces a extensive metabolic developmental program in order to ensure its transmission. In the hemolymph of the mosquito the dynamics of lipid metabolism is conducted by a major lipoprotein, lipophorin (Lp). It was recently shown that Lp is engaged in the mosquito immune response to parasite infection. However, it is not clear if Lp is uptaken by the parasite. Here, we show that oocysts are able to uptake mosquito Lp. The uptake of FITC-labeled Lp was demonstrated in midgut-associated oocysts. Alternatively, to confirm Lp incorporation by oocysts we have conducted another set of experiments with iodinated Lp ((125)I-Lp). Oocysts were able to incorporate (125)I-Lp and the process is both time and temperature dependent. This set of results indicated that no matter oocysts are attached to mosquito midgut wall they bear a lipid sequestering machinery from its surroundings. Phospholipid transfer to sporozoites was also demonstrated. In conclusion, these results demonstrate for the first time that malaria parasite undergoes lipid uptake while in the invertebrate host.

Anti-plasmodium activity of angiotensin II and related synthetic peptides.

Plasmodium species are the causative agents of malaria, the most devastating insect-borne parasite of human populations. Finding and developing new drugs for malaria treatment and prevention is the goal of much research. Angiotensins I and II (ang I and ang II) and six synthetic related peptides designated Vaniceres 1-6 (VC1-VC6) were assayed in vivo and in vitro for their effects on the development of the avian parasite, Plasmodium gallinaceum. Ang II and VC5 injected into the thoraces of the insects reduced mean intensities of infection in the mosquito salivary glands by 88% and 76%, respectively. Although the mechanism(s) of action is not completely understood, we have demonstrated that these peptides disrupt selectively the P.gallinaceum cell membrane. Additionally, incubation in vitro of sporozoites with VC5 reduced the infectivity of the parasites to their vertebrate host. VC5 has no observable agonist effects on vertebrates, and this makes it a promising drug for malaria prevention and chemotherapy.

The avian malaria parasite Plasmodium gallinaceum causes marked structural changes on the surface of its host erythrocyte.

Using a combination of atomic force, scanning and transmission electron microscopy, we found that avian erythrocytes infected with the avian malaria parasite Plasmodium gallinaceum develop approximately 60 nm wide and approximately 430 nm long furrow-like structures on the surface. Furrows begin to appear during the early trophozoite stage of the parasite's development. They remain constant in size and density during the course of parasite maturation and are uniformly distributed in random orientations over the erythrocyte surface. In addition, the density of furrows is directly proportional to the number of parasites contained within the erythrocyte. These findings suggest that parasite-induced intraerythrocytic processes are involved in modifying the surface of host erythrocytes. These processes may be analogous to those of the human malaria parasite P. falciparum, which induces knob-like protrusions that mediate the pathogenic adherence of parasitized erythrocytes to microvessels. Although P. gallinaceum-infected erythrocytes do not seem to adhere to microvessels in the host chicken, the furrows might be involved in the pathogenesis of P. gallinaceum infections by some other mechanism involving host-pathogen interactions.

The novel Plasmodium gallinaceum sporozoite protein, Pg93, is preferentially expressed in the nucleus of oocyst sporozoites.

To study gene expression differences between oocyst and salivary gland sporozoites, cDNA libraries previously constructed from the two sporozoite populations of the avian malaria parasite, Plasmodium gallinaceum, were used in a subtractive hybridization protocol to isolate Pg93, a novel oocyst sporozoite gene. Pg93 encodes a putative approximately 76 kDa translated protein that was predicted to localize to the nucleus. Transcriptional analysis indicates that Pg93 is preferentially expressed in oocyst sporozoites versus salivary gland sporozoites. Immunolocalization assays confirm both the nuclear prediction and transcriptional analysis, suggesting that Pg93 is a nuclear protein. BLAST sequence analysis indicates that Pg93 represents a novel gene that has significant homology with a Plasmodium falciparum hypothetical protein and translated Plasmodium knowlesi and Plasmodium vivax nucleotide sequences. This is the first characterization of a Plasmodium nuclear protein that shows preferential expression in one sporozoite population as compared with the other population.

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants.

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.

Inhibition of Ca2+/calmodulin-dependent protein kinase blocks morphological differentiation of plasmodium gallinaceum zygotes to ookinetes.

Once ingested by mosquitoes, malaria parasites undergo complex cellular changes. These include zygote formation, transformation of zygote to ookinete, and differentiation from ookinete to oocyst. Within the oocyst, the parasite multiplies into numerous sporozoites. Modulators of intracellular calcium homeostasis, MAPTAM, and TMB-8 blocked ookinete development as did the calmodulin (CaM) antagonists W-7 and calmidazolium. Ca(2+)/CaM-dependent protein kinase inhibitor KN-93 also blocked zygote elongation, while its ineffective analog KN-92 did not have such effect. In vitro both zygote and ookinete extracts efficiently phosphorylated autocamtide-2, a classic CaM kinase substrate, which could be blocked by calmodulin antagonists W-7 and calmidazolium and CaM kinase inhibitor KN-93. These results demonstrated the presence of calmodulin-dependent CaM kinase activity in the parasite. KN-93-treated parasites, however, expressed the ookinete-specific enzyme chitinase and the ookinete surface antigen Pgs28 normally, suggesting that the morphologically untransformed parasites are biochemically mature ookinetes. In mosquitoes, KN-93-treated parasites did not develop as oocysts, while KN-92-treated parasites produced similar numbers of oocysts as controls. These data suggested that in Plasmodium gallinaceum morphological development of zygote to ookinete, but not its biochemical maturation, relies on Ca(2+)/CaM-dependent protein kinase activity and demonstrated that the morphological differentiation is essential for the further development of the parasite in infected blood-fed mosquitoes.

The signal sequence and C-terminal hydrophobic domain are required for localization of the sexual stage antigen pgs28 to the surface of P. gallinaceum ookinetes.

The Pgs28 protein is a major surface antigen of the sexual stages of Plasmodium gallinaceum the zygotes and the ookinetes. The protein contains conserved motifs, namely an N-terminal signal sequence, four epidermal growth factor-like repeats and a C-terminal hydrophobic domain that serves as a signal for glycosylphosphatidylinositol (GPI)--anchor modification. In this study, we define the protein motifs required for the surface localization of Pgs28 in ookinetes. using transient transfection combined with immunofluorescence and confocal microscopy. Pgs28 fused to the green fluorescent protein (Pgs28-GFP) is expressed in zygotes, intermediate retort forms and ookinetes. Mutational analyses of Pgs28 coding regions reveal that deletions of the signal sequence and the C-terminal domain result in intracellular retention of the fusion protein. Therefore, the signal sequence and C-terminal domain are required for cell surface localization. Additionally, the Pgs28-GFP fusion proteins are shed from the surface of live ookinetes, suggesting that Pgs28 may be involved in interactions with the cells of the mosquito midgut or during motility.

3' UTR elements enhance expression of Pgs28, an ookinete protein of Plasmodium gallinaceum.

In Plasmodium parasites the fusion of gametes to form a fertilized zygote and morphogenesis into the motile ookinete are critical developmental stages in the parasite's complex life cycle. In analogous developmental stages of metazoan organisms 3' gene flanking regions are critical in the regulation of gene expression. To determine whether these mechanisms are conserved in the protozoan parasite we studied the 3' gene flanking elements necessary for the expression of Pgs28, the major surface protein of mature zygotes and ookinetes of the chicken malaria Plasmodium gallinaceum. The DNA sequence of the pgs28 3' gene flanking region contains 7 eukaryotic polyadenylation consensus signals (AATAAA/ATTAAA). An unusual 82% T-rich region is located 55 nucleotides upstream of the fifth polyadenylation signal (ATTAAA). The pgs28 mRNA terminates approximately 20 nucleotides from the polyadenylation signal in a poly (A) tail. To determine whether the T-rich region and polyadenylation signals were necessary for Pgs28 protein expression, sexual stage parasites were transfected with plasmids containing deletions of these elements utilizing firefly luciferase (LUC) and beta-glucuronidase (GUS) as markers of transient gene transfection. The parasites were allowed to develop in vitro to the ookinete stage and assayed for enzymatic activity. Cells transfected with plasmids containing deletions of the T-rich region or fifth eukaryotic polyadenylation consensus signal expressed 89 and 92%, less enzymatic activity respectively than those transfected with the full length pgs28 3' gene flanking region. The U-rich element and fifth eukaryotic polyadenylation consensus sequence within the pgs28 3' UTR are therefore necessary for Pgs28 protein expression.

Identification of surface molecules on salivary glands of the mosquito, Aedes aegypti, by a panel of monoclonal antibodies.

Malaria transmission by the mosquito vector requires sporozoite invasion into mosquito salivary glands. Parasites probably enter the glands by specific receptor-ligand interactions with molecules on the surface of the glands. We have undertaken the characterization of salivary gland surface molecules of Aedes aegypti to identify candidate receptors for Plasmodium gallinaceum sporozoite invasion. Monoclonal antibodies (mAbs) were generated against antigen enriched for salivary gland membranes and basal lamina. A panel of 44 mAbs were generated that bound to surface molecules of mosquito tissues. Twenty-four mAbs bound exclusively to salivary glands, six bound to salivary glands and ovaries, one bound to salivary gland and midgut, and 13 bound to all tissues tested. We present data on the immunolocalization and biochemical characteristics of the antigens. Many of the salivary gland-specific mAbs bound preferentially to the median and distal lateral lobes of the salivary glands, indicating that there are anatomical region-specific biochemical differences on the gland surface. These lobes of the salivary glands are the preferential sites of malaria sporozoite invasion. Therefore, antigens specific for these regions are promising candidate receptors for sporozoite invasion. The present identification of surface molecules of mosquito salivary glands by means of monoclonal antibodies represents the first description of individual molecules on the mosquito salivary gland surface. This work lays the basis for further studies on the molecular mechanisms involved in malaria sporozoite invasion of mosquito salivary glands.

[Are sugars always necessary for the infection of mosquitoes with malarial plasmodia?]. / Vsegda li neobkhodimy sakhara dlia zarazheniia komarov plazmodiiami maliarii?

The possibility of the completion of the sporogony cycle of Plasmodium gallinaceum in Aedes aegypti mosquitoes, which were not given preliminary carbohydrate feeding, is considered. The significance of the obtained data for tracing the connection between the type of feeding of arthropods and their ability to be specific vectors of agents of transmissible infections is discussed.