Initiation of hnRNPA1 Low-Complexity Domain Condensation Monitored by Dynamic Light Scattering.

Biomolecular condensates (BMCs) exhibit physiological and pathological relevance in biological systems. Both liquid and solid condensates play significant roles in the spatiotemporal regulation and organization of macromolecules and their biological activities. Some pathological solid condensates, such as Lewy Bodies and other fibrillar aggregates, have been hypothesized to originate from liquid condensates. With the prevalence of BMCs having functional and dysfunctional roles, it is imperative to understand the mechanism of biomolecular condensate formation and initiation. Using the low-complexity domain (LCD) of heterogenous ribonuclear protein A1 (hnRNPA1) as our model, we monitored initial assembly events using dynamic light scattering (DLS) while modulating pH and salt conditions to perturb macromolecule and condensate properties. We observed the formation of nanometer-sized BMCs (nano-condensates) distinct from protein monomers and micron-sized condensates. We also observed that conditions that solubilize micron-sized protein condensates do not solubilize nano-condensates, indicating that the balance of forces that stabilize nano-condensates and micron-sized condensates are distinct. These findings provide insight into the forces that drive protein phase separation and potential nucleation structures of macromolecular condensation.

Thermodynamic coupling of the tandem RRM domains of hnRNP A1 underlie its pleiotropic RNA binding functions.

The functional properties of RNA binding proteins (RBPs) require allosteric regulation through interdomain communication. Despite the importance of allostery to biological regulation, only a few studies have been conducted to describe the biophysical nature by which interdomain communication manifests in RBPs. Here, we show for hnRNP A1 that interdomain communication is vital for the unique stability of its amino-terminal domain, which consists of two RNA recognition motifs (RRMs). These RRMs exhibit drastically different stability under pressure. RRM2 unfolds as an individual domain but remains stable when appended to RRM1. Variants that disrupt interdomain communication between the tandem RRMs show a significant decrease in stability. Carrying these mutations over to the full-length protein for in vivo experiments revealed that the mutations affected the ability of the disordered carboxyl-terminal domain to engage in protein-protein interactions and influenced the protein's RNA binding capacity. Collectively, this work reveals that thermodynamic coupling between the tandem RRMs of hnRNP A1 accounts for its allosteric regulatory functions.

Targeting Ser78 phosphorylation of Hsp27 achieves potent antiviral effects against enterovirus A71 infection.

A positive-sense (+) single-stranded RNA (ssRNA) virus (e.g. enterovirus A71, EV-A71) depends on viral polypeptide translation for initiation of virus replication after entry. We reported that EV-A71 hijacks Hsp27 to induce hnRNP A1 cytosol redistribution to initiate viral protein translation, but the underlying mechanism is still elusive. Here, we show that phosphorylation-deficient Hsp27-3A (Hsp27S15/78/82A) and Hsp27S78A fail to translocate into the nucleus and induce hnRNP A1 cytosol redistribution, while Hsp27S15A and Hsp27S82A display similar effects to the wild type Hsp27. Furthermore, we demonstrate that the viral 2A protease (2Apro) activity is a key factor in regulating Hsp27/hnRNP A1 relocalization. Hsp27S78A dramatically decreases the IRES activity and viral replication, which are partially reduced by Hsp27S82A. However, Hsp27S15A displays the same activity as the wild-type Hsp27. Peptide S78 potently suppresses EV-A71 protein translation and reproduction through blockage of EV-A71-induced Hsp27 phosphorylation and Hsp27/hnRNP A1 relocalization. A point mutation (S78A) on S78 impairs its inhibitory functions on Hsp27/hnRNP A1 relocalization and viral replication. Taken together, we demonstrate the importance of Ser78 phosphorylation of Hsp27 regulated by virus infection in nuclear translocation, hnRNP A1 cytosol relocation, and viral replication, suggesting a new path (such as peptide S78) for target-based antiviral strategy.

Downregulation of HNRNPA1 induced neoantigen generation via regulating alternative splicing.

BACKGROUND: Immunotherapies effectively treat human malignancies, but the low response and resistance are major obstacles. Neoantigen is an emerging target for tumor immunotherapy that can enhance anti-tumor immunity and improve immunotherapy. Aberrant alternative splicing is an important source of neoantigens. HNRNPA1, an RNA splicing factor, was found to be upregulated in the majority of tumors and play an important role in the tumor immunosuppressive microenvironment. METHODS: Whole transcriptome sequencing was performed on shHNRNPA1 SKOV3 cells and transcriptomic data of shHNRNPA1 HepG2, MCF-7M, K562, and B-LL cells were downloaded from the GEO database. Enrichment analysis was performed to elucidate the mechanisms underlying the activation of anti-tumor immunity induced by HNRNPA1 knockdown. mRNA alternative splicing was analyzed and neoantigens were predicted by JCAST v.0.3.5 and Immune epitope database. The immunogenicity of candidate neoantigens was calculated by Class I pMHC Immunogenicity and validated by the IFN-γ ELISpot assay. The effect of shHNRNPA1 on tumor growth and immune cells in vivo was evaluated by xenograft model combined with immunohistochemistry. RESULTS: HNRNPA1 was upregulated in a majority of malignancies and correlated with immunosuppressive status of the tumor immune microenvironment. Downregulation of HNRNPA1 could induce the activation of immune-related pathways and biological processes. Disruption of HNRNPA1 resulted in aberrant alternative splicing events and generation of immunogenic neoantigens. Downregulation of HNRNPA1 inhibited tumor growth and increased CD8+ T cell infiltration in vivo. CONCLUSION: Our study demonstrated that targeting HNRNPA1 could produce immunogenic neoantigens that elicit anti-tumor immunity by inducing abnormal mRNA splicing. It suggests that HNRNPA1 may be a potential target for immunotherapy.

SNHG15-mediated feedback loop interplays with HNRNPA1/SLC7A11/GPX4 pathway to promote gastric cancer progression.

Dysregulation of long noncoding RNA (lncRNA) expression plays a pivotal role in the initiation and progression of gastric cancer (GC). However, the regulation of lncRNA SNHG15 in GC has not been well studied. Mechanisms for ferroptosis by SNHG15 have not been revealed. Here, we aimed to explore SNHG15-mediated biological functions and underlying molecular mechanisms in GC. The novel SNHG15 was identified by analyzing RNA-sequencing (RNA-seq) data of GC tissues from our cohort and TCGA dataset, and further validated by qRT-PCR in GC cells and tissues. Gain- and loss-of-function assays were performed to examine the role of SNHG15 on GC both in vitro and in vivo. SNHG15 was highly expressed in GC. The enhanced SNHG15 was positively correlated with malignant stage and poor prognosis in GC patients. Gain- and loss-of-function studies showed that SNHG15 was required to affect GC cell growth, migration and invasion both in vitro and in vivo. Mechanistically, the oncogenic transcription factors E2F1 and MYC could bind to the SNHG15 promoter and enhance its expression. Meanwhile, SNHG15 increased E2F1 and MYC mRNA expression by sponging miR-24-3p. Notably, SNHG15 could also enhance the stability of SLC7A11 in the cytoplasm by competitively binding HNRNPA1. In addition, SNHG15 inhibited ferroptosis through an HNRNPA1-dependent regulation of SLC7A11/GPX4 axis. Our results support a novel model in which E2F1- and MYC-activated SNHG15 regulates ferroptosis via an HNRNPA1-dependent modulation of the SLC7A11/GPX4 axis, which serves as the critical effectors in GC progression, and provides a new therapeutic direction in the treatment of GC.

circLIFR-007 reduces liver metastasis via promoting hnRNPA1 nuclear export and YAP phosphorylation in breast cancer.

Cancer metastasis is the major cause of death in patients with breast cancer (BC). The liver is a common site of breast cancer metastasis, and the 5-year survival rate of patients with breast cancer liver metastases (BCLMs) is only about 8.5 %. CircRNAs are involved in a variety of cancer-related pathological behaviors, and their unique structure and resistance to RNA degradation enable them to serve as ideal diagnostic biomarkers and therapeutic targets. Therefore, it is important to investigate the role and molecular mechanism of circRNAs in cancer metastasis. CircLIFR-007 was identified as a critical circular RNA in BC metastasis by circRNAs microarray and qRT-PCR experiment. Cell function assays were performed to explore the effect of circLIFR-007 in breast cancer cells. Experiments in vivo validated the function of circLIFR-007. Several molecular assays were performed to investigate the underlying mechanisms. We found that circLIFR-007 acted as a negative controller in breast cancer liver metastasis. CircLIFR-007 upregulates the phosphorylation level of YAP by exporting hnRNPA1 to promote the combination between hnRNPA1 and YAP in the cytoplasm. Overexpression of circLIFR-007 suppressed the expression of liver metastasis-related proteins, SREBF1 and SNAI1, which were regulated by transcription factor YAP. Functionally, circLIFR-007 inhibits the proliferation and metastasis of breast cancer cells both in vivo and in vitro.

RNA modulates hnRNPA1A amyloid formation mediated by biomolecular condensates.

Several RNA binding proteins involved in membraneless organelles can form pathological amyloids associated with neurodegenerative diseases, but the mechanisms of how this aggregation is modulated remain elusive. Here we investigate how heterotypic protein-RNA interactions modulate the condensation and the liquid to amyloid transition of hnRNPA1A, a protein involved in amyothropic lateral sclerosis. In the absence of RNA, formation of condensates promotes hnRNPA1A aggregation and fibrils are localized at the interface of the condensates. Addition of RNA modulates the soluble to amyloid transition of hnRNPA1A according to different pathways depending on RNA/protein stoichiometry. At low RNA concentrations, RNA promotes both condensation and amyloid formation, and the catalytic effect of RNA adds to the role of the interface between the dense and dilute phases. At higher RNA concentrations, condensation is suppressed according to re-entrant phase behaviour but formation of hnRNPA1A amyloids is observed over longer incubation times. Our findings show how heterotypic nucleic acid-protein interactions affect the kinetics and molecular pathways of amyloid formation.

Exosomes secreted by Fusobacterium nucleatum-infected colon cancer cells transmit resistance to oxaliplatin and 5-FU by delivering hsa_circ_0004085.

BACKGROUND: A large number of Fusobacterium nucleatum (Fn) are present in colorectal cancer (CRC) tissues of patients who relapse after chemotherapy, and Fn has been reported to promote oxaliplatin and 5-FU chemoresistance in CRC. Pathogens such as bacteria and parasites stimulate exosome production in tumor cells, and the regulatory mechanism of exosomal circRNA in the transmission of oxaliplatin and 5-FU chemotherapy resistance in Fn-infected CRC remains unclear. METHODS: Hsa_circ_0004085 was screened by second-generation sequencing of CRC tissues. The correlation between hsa_circ_0004085 and patient clinical response to oxaliplatin/5-FU was analyzed. Exosome tracing experiments and live imaging systems were used to test the effect of Fn infection in CRC on the distribution of hsa_circ_0004085. Colony formation, ER tracking analysis and immunofluorescence were carried out to verify the regulatory effect of exosomes produced by Fn-infected CRC cells on chemotherapeutic resistance and ER stress. RNA pulldown, LC-MS/MS analysis and RIP were used to explore the regulatory mechanism of downstream target genes by hsa_circ_0004085. RESULTS: First, we screened out hsa_circ_0004085 with abnormally high expression in CRC clinical samples infected with Fn and found that patients with high expression of hsa_circ_0004085 in plasma had a poor clinical response to oxaliplatin/5-FU. Subsequently, the circular structure of hsa_circ_0004085 was identified. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes produced by Fn-infected CRC cells transferred hsa_circ_0004085 between cells and delivered oxaliplatin/5-FU resistance to recipient cells by relieving ER stress. Hsa_circ_0004085 enhanced the stability of GRP78 mRNA by binding to RRBP1 and promoted the nuclear translocation of ATF6p50 to relieve ER stress. CONCLUSIONS: Plasma levels of hsa_circ_0004085 are increased in colon cancer patients with intracellular Fn and are associated with a poor response to oxaliplatin/5-FU. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes secreted by Fn-infected CRC cells deliver hsa_circ_0004085 between cells. Hsa_circ_0004085 relieves ER stress in recipient cells by regulating GRP78 and ATF6p50, thereby delivering resistance to oxaliplatin and 5-FU.

Phosphorylation of hnRNP A1-Serine 199 Is Not Required for T Cell Differentiation and Function.

hnRNP A1 is an important RNA-binding protein that influences many stages of RNA processing, including transcription, alternative splicing, mRNA nuclear export, and RNA stability. However, the role of hnRNP A1 in immune cells, specifically CD4+ T cells, remains unclear. We previously showed that Akt phosphorylation of hnRNP A1 was dependent on TCR signal strength and was associated with Treg differentiation. To explore the impact of hnRNP A1 phosphorylation by Akt on CD4+ T cell differentiation, our laboratory generated a mutant mouse model, hnRNP A1-S199A (A1-MUT) in which the major Akt phosphorylation site on hnRNP A1 was mutated to alanine using CRISPR Cas9 technology. Immune profiling of A1-MUT mice revealed changes in the numbers of Tregs in the mesenteric lymph node. We found no significant differences in naive CD4+ T cell differentiation into Th1, Th2, Th17, or T regulatory cells (Tregs) in vitro. In vivo, Treg differentiation assays using OTII-A1-Mut CD4+ T cells exposed to OVA food revealed migration and homing defects in the A1-MUT but no change in Treg induction. A1-MUT mice were immunized with NP- keyhole limpet hemocyanin, and normal germinal center development, normal numbers of NP-specific B cells, and no change in Tfh numbers were observed. In conclusion, Akt phosphorylation of hnRNP A1 S199 does not play a role in CD4+ T cell fate or function in the models tested. This hnRNP A1-S199A mouse model should be a valuable tool to study the role of Akt phosphorylation of hnRNP A1-S199 in different cell types or other mouse models of human disease.

Embryonic stem cell related gene regulates alternative splicing of transcription factor 3 to maintain human embryonic stem cells' self-renewal and pluripotency.

Exploring the mechanism of self-renewal and pluripotency maintenance of human embryonic stem cells (hESCs) is of great significance in basic research and clinical applications, but it has not been fully elucidated. Long non-coding RNAs (lncRNAs) have been shown to play a key role in the self-renewal and pluripotency maintenance of hESCs. We previously reported that the lncRNA ESRG, which is highly expressed in undifferentiated hESCs, can maintain the self-renewal and pluripotency of hPSCs. RNA pull-down mass spectrometry showed that ESRG could bind to other proteins, among which heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) attracted our attention. In this study, we showed that HNRNPA1 can maintain self-renewal and pluripotency of hESCs. ESRG bound to and stabilized HNRNPA1 protein through the ubiquitin-proteasome pathway. In addition, knockdown of ESRG or HNRNPA1 resulted in alternative splicing of TCF3, which originally and primarily encoded E12, to mainly encode E47 and inhibit CDH1 expression. HNRNPA1 could rescue the biological function changes of hESCs caused by ESRG knockdown or overexpression. Our results suggest that ESRG regulates the alternative splicing of TCF3 to affect CDH1 expression and maintain hESCs self-renewal and pluripotency by binding and stabilizing HNRNPA1 protein. This study lays a good foundation for exploring the new molecular regulatory mechanism by which ESRG maintains hESCs self-renewal and pluripotency.

The microRNA-195-5p/hnRNP A1 axis contributes to the progression of hepatocellular carcinoma by regulating the migration of cancer cells.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

The mechanism of UP1 binding and unfolding of human telomeric DNA G-quadruplex.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

HnRNP A1 Suppresses the Odontogenic Differentiation and the Inclusion of RUNX2 Exon 5 of Dental Mesenchymal Cells.

BACKGROUND: RUNX2 (Runt-related transcription factor 2) acts as a key regulator in the odontogenic differentiation of human dental pulp stem cells (hDPSCs). Moreover, the inclusion of exon 5 is important for RUNX2 function. Our previous study showed that Y-Box Binding Protein 1 (YBX1) promoted RUNX2 exon 5 inclusion and mineralization of hDPSCs. However, the regulatory mechanism of RUNX2 exon 5 alternative splicing needed further exploration. METHODS: The expression level of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) during the odontogenic differentiation of hDPSCs was analyzed by RT-PCR and Western blot. The roles of hnRNP A1 in the alternative splicing of RUNX2 exon 5 and the odontogenic differentiation of dental mesenchymal cells were analyzed by gain- and loss-of-function experiments. RESULTS: Surprisingly, we found an alternative splicing factor, hnRNP A1, which had an opposite role to YBX1 in regulating RUNX2 exon 5 inclusion and odontogenic differentiation of hDPSCs. Through gain- and loss-of-function assay, we found that hnRNP A1 suppressed the inclusion of RUNX2 exon 5, resulting in the inhibition of odontoblastic differentiation. The overexpression of hnRNP A1 can inhibit the expression of ALP (alkaline phosphatase) and OCN (osteocalcin), and the formation of mineralized nodules during the odontogenic differentiation of both hDPSCs and mouse dental papilla cells (mDPCs), whereas the opposite results were obtained with an hnRNP A1 knockdown preparation. CONCLUSIONS: The present study indicated that hnRNP A1 suppressed RUNX2 exon 5 inclusion and reduced the odontogenic differentiation ability of hDPSCs and mDPCs.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

m6A-modification of cyclin D1 and c-myc IRESs in glioblastoma controls ITAF activity and resistance to mTOR inhibition.

A major mechanism conferring resistance to mTOR inhibitors is activation of a salvage pathway stimulating internal ribosome entry site (IRES)-mediated mRNA translation, driving the synthesis of proteins promoting resistance of glioblastoma (GBM). Previously, we found this pathway is stimulated by the requisite IRES-trans-acting factor (ITAF) hnRNP A1, which itself is subject to phosphorylation and methylation events regulating cyclin D1 and c-myc IRES activity. Here we describe the requirement for m6A-modification of IRES RNAs for efficient translation and resistance to mTOR inhibition. DRACH-motifs within these IRES RNAs upon m6A modification resulted in enhanced IRES activity via increased hnRNP A1-binding following mTOR inhibitor exposure. Inhibitor exposure stimulated the expression of m6A-methylosome components resulting in increased activity in GBM. Silencing of METTL3-14 complexes reduced IRES activity upon inhibitor exposure and sensitized resistant GBM lines. YTHDF3 associates with m6A-modified cyclin D1 or c-myc IRESs, regulating IRES activity, and mTOR inhibitor sensitivity in vitro and in xenograft experiments. YTHDF3 interacted directly with hnRNP A1 and together stimulated hnRNP A1-dependent nucleic acid strand annealing activity. These data demonstrate that m6A-methylation of IRES RNAs regulate GBM responses to this class of inhibitors.

Role of Heterogeneous Nuclear Ribonucleoproteins in the Cancer-Immune Landscape.

Cancer remains the second leading cause of death, accounting for approximately 20% of all fatalities. Evolving cancer cells and a dysregulated immune system create complex tumor environments that fuel tumor growth, metastasis, and resistance. Over the past decades, significant progress in deciphering cancer cell behavior and recognizing the immune system as a hallmark of tumorigenesis has been achieved. However, the underlying mechanisms controlling the evolving cancer-immune landscape remain mostly unexplored. Heterogeneous nuclear ribonuclear proteins (hnRNP), a highly conserved family of RNA-binding proteins, have vital roles in critical cellular processes, including transcription, post-transcriptional modifications, and translation. Dysregulation of hnRNP is a critical contributor to cancer development and resistance. HnRNP contribute to the diversity of tumor and immune-associated aberrant proteomes by controlling alternative splicing and translation. They can also promote cancer-associated gene expression by regulating transcription factors, binding to DNA directly, or promoting chromatin remodeling. HnRNP are emerging as newly recognized mRNA readers. Here, we review the roles of hnRNP as regulators of the cancer-immune landscape. Dissecting the molecular functions of hnRNP will provide a better understanding of cancer-immune biology and will impact the development of new approaches to control and treat cancer.

ß-Hydroxybutyrate alleviates cartilage senescence through hnRNP A1-mediated up-regulation of PTEN.

Senescence chondrocytes play an important role in Osteoarthritis (OA) progression. However, alleviating OA progression through senescent chondrocyte intervention still faces great challenges. ß-Hydroxybutyrate (BHB) exhibits anti-senescence effects in a variety of age-related dis-eases, but its role in osteoarthritis remains poorly understood. To explore the molecular mechanisms, gene sequencing was used to identify critical genes and potential cellular signaling pathways and male SD rats were used to generate an osteoarthritis model. Results showed that BHB attenuated the senescence of Osteoarthritis chondrocytes (OA-Chos) and alleviated OA progression. Gene ontology (GO) enrichment analysis revealed significant changes in cell cycle genes, with PTEN being the most significant differentially expressed gene. BHB up-regulated the expression of PTEN in OA-Chos, thereby alleviating chondrocyte senescence. Furthermore, BHB facilitated the expression of PTEN by binding to hnRNP A1 and inhibiting the phosphorylation of Akt. This study provided evidence that BHB mitigated chondrocyte senescence and delayed OA, and could thus be used as a novel therapeutic approach for osteoarthritis treatment.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

hnRNP A1 dysfunction in oligodendrocytes contributes to the pathogenesis of multiple sclerosis.

Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.

A splicing silencer in SMN2 intron 6 is critical in spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a fatal neuromuscular disease caused by homozygous deletions or mutations of the SMN1 gene. SMN2 is a paralogous gene of SMN1 and a modifying gene of SMA. A better understanding of how SMN2 exon 7 splicing is regulated helps discover new therapeutic targets for SMA therapy. Based on an antisense walk method to map exonic and intronic splicing silencers (ESSs and ISSs) in SMN2 exon 7 and the proximal regions of its flanking introns, we identified one ISS (ISS6-KH) at upstream of the branch point site in intron 6. By using mutagenesis-coupled RT-PCR with SMN1/2 minigenes, immunochromatography, overexpression and siRNA-knockdown, we found this ISS consists of a bipartite hnRNP A1 binding cis-element and a poly-U sequence located between the proximal hnRNP A1 binding site (UAGCUA) and the branch site. Both HuR and hnRNP C1 proteins promote exon 7 skipping through the poly-U stretch. Mutations or deletions of these motifs lead to efficient SMN2 exon 7 inclusion comparable to SMN1 gene. Furthermore, we identified an optimal antisense oligonucleotide that binds the intron six ISS and causes striking exon 7 inclusion in the SMN2 gene in patient fibroblasts and SMA mouse model. Our findings demonstrate that this novel ISS plays an important role in SMN2 exon 7 skipping and highlight a new therapeutic target for SMA therapy.