Formation of the N≡N Triple Bond from Reductive Coupling of a Paramagnetic Diruthenium Nitrido Compound.

Construction of nitrogen-nitrogen triple bonds via homocoupling of metal nitrides is an important fundamental reaction relevant to a potential Nitrogen Economy. Here, we report that room temperature photolysis of Ru2(chp)4N3 (chp- = 2-chloro-6-hydroxypyridinate) in CH2Cl2 produces N2 via reductive coupling of Ru2(chp)4N nitrido species. Computational analysis reveals that the nitride coupling transition state (TS) features an out-of-plane "zigzag" geometry instead of the anticipated planar zigzag TS. However, with intentional exclusion of dispersion correction, the planar zigzag TS geometry can also be found. Both the out-of-plane and planar zigzag TS geometries feature two important types of orbital interactions: (1) donor-acceptor interactions involving intermolecular donation of a nitride lone pair into an empty Ru-N π* orbital and (2) Ru-N π to Ru-N π* interactions derived from coupling of nitridyl radicals. The relative importance of these two interactions is quantified both at and after the TS. Our analysis shows that both interactions are important for the formation of the N-N σ bond, while radical coupling interactions dominate the formation of N-N π bonds. Comparison is made to isoelectronic Ru2-oxo compounds. Formation of an O-O bond via bimolecular oxo coupling is not observed experimentally and is calculated to have a much higher TS energy. The major difference between the nitrido and oxo systems stems from an extremely large driving force, ∼-500 kJ/mol, for N-N coupling vs a more modest driving force for O-O coupling, -40 to -140 kJ/mol.

Exploring the potential of highly charged Ru(II)- and heteronuclear Ru(II)/Cu(II)-polypyridyl complexes as antimicrobial agents.

The antimicrobial potential of two ruthenium(II) polypyridyl complexes, [Ru(phen)2L1]2+ and [Ru(phen)2L2]2+ (phen = 1,10-phenanthroline) containing the 4,4'-(2,5,8,11,14-pentaaza[15])-2,2'-bipyridilophane (L1) and the 4,4'-bis-[methylen-(1,4,7,10-tetraazacyclododecane)]-2,2' bipyridine (L2) units, is herein investigated. These peculiar polyamine frameworks afford the formation of highly charged species in solution, influence the DNA-binding and cleavage properties of compounds, but they do not undermine their singlet oxygen sensitizing capacities, thus making these complexes attractive 1O2 generators in aqueous solution. L1 and L2 also permit to stably host Fenton -active Cu2+ ion/s, leading to the formation of mixed Ru2+/Cu2+ forms capable to further strengthen the oxidative damages to biological targets. Herein, following a characterization of the Cu2+ binding ability by [Ru(phen)2L2]2+, the water-octanol distribution coefficients, the DNA binding, cleavage and 1O2 sensitizing properties of [Ru(phen)2L2]2+ and [Cu2Ru(phen)2L2]6+ were analysed and compared with those of [Ru(phen)2L1]2+ and [CuRu(phen)2L1]4+. The antimicrobial activity of all compounds was evaluated against B. subtilis, chosen as a model for gram-positive bacteria, both under dark and upon light-activation. Our results unveil a notable phototoxicity of [Ru(phen)2L2]2+ and [Cu2Ru(phen)2L2]6+, with MIC (minimal inhibitory concentrations) values of 3.12 µM. This study highlights that the structural characteristics of polyamine ligands gathered on highly charged Ru(II)-polypyridyl complexes are versatile tools that can be exploited to achieve enhanced antibacterial strategies.

Water-Assisted Concerted Proton-Electron Transfer at Co(II)-Aquo Sites in Polyoxotungstates With Photogenerated RuIII (bpy)33+ Oxidant.

The cobalt substituted polyoxotungstate [Co6 (H2 O)2 (α-B-PW9 O34 )2 (PW6 O26 )]17- (Co6) displays fast electron transfer (ET) kinetics to photogenerated RuIII (bpy)33+ , 4 to 5 orders of magnitude faster than the corresponding ET observed for cobalt oxide nanoparticles. Mechanistic evidence has been acquired indicating that: (i) the one-electron oxidation of Co6 involves Co(II) aquo or Co(II) hydroxo groups (abbreviated as Co6(II)-OH2 and Co6(II)-OH, respectively, whose speciation in aqueous solution is associated to a pKa of 7.6), and generates a Co(III)-OH moiety (Co6(III)-OH), as proven by transient absorption spectroscopy; (ii) at pH>pKa , the Co6(II)-OH→RuIII (bpy)33+ ET occurs via bimolecular kinetics, with a rate constant k close to the diffusion limit and dependent on the ionic strength of the medium, consistent with reaction between charged species; (iii) at pH

Peptide-Ruthenium Conjugate as an Efficient Photosensitizer for the Inactivation of Multidrug-Resistant Bacteria.

Antimicrobial photodynamic therapy (APDT) has gained increased attention because of its broad spectrum activity and lower likelihood to elicit bacterial resistance. Although many photosensitizers excel at eradicating Gram-positive bacterial infections, they are generally less potent when utilized against Gram-negative bacteria. We hypothesized that conjugating the DNA-targeting, antimicrobial peptide buforin II to a metal-based photosensitizer would result in a potent APDT agent. Herein, we present the synthesis and characterization of a buforin II-[Ru(bpy)3]2+ bioconjugate (1). The submicromolar activity of 1 against the multidrug-resistant strains Escherichia coli AR 0114 and Acinetobacter baumannii Naval-17 indicates strong synergy between the ruthenium complex and buforin II. Our mechanistic studies point to an increased rate of DNA damage by 1 compared to [Ru(bpy)3]2+. These results suggest that conjugating metal complexes to antimicrobial peptides can lead to potent antimicrobial agents.

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects.

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4'-(anthracene-9-yl)-2,2':6',2''-terpyridine and bpy = 2,2'-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 µM).

Two photoactive Ru (II) compounds based on tetrazole ligands for photodynamic therapy.

Ru (II) compounds have potential application in photodynamic therapy (PDT). In the current study, two Ru (II) compounds based on the auxiliary ligand 2,2'-bipyridine (bipy) by changing main ligands 5-(2-pyridyl) tetrazole (Hpytz) and di(2H-tetrazol-5-yl) amine (H2datz) have been successfully synthesized and characterized, [Ru (pytz)(bipy)2][PF6] (1) and [Ru(Hdatz)(bipy)2][PF6] (2). These compounds can form nanoparticles (NPs) by nano-precipitation. And [Ru(pytz)(bipy)2][PF6] NPs with a lower half maximal inhibitory concentration (IC50) of 37 µg/mL on HeLa cells than that of [Ru(Hdatz)(bipy)2][PF6] NPs (65 µg/mL). Meanwhile, negligible dark toxicity has been also observed for these NPs even under high concentrations. The results show that [Ru(pytz)(bipy)2][PF6] (1) and [Ru(Hdatz)(bipy)2][PF6] (2) NPs can inhibit cell proliferation in vitro, and may be potential candidates for photodynamic therapy.

A lysosome-targeted ruthenium(II) polypyridyl complex as photodynamic anticancer agent.

Polypyridyl ruthenium complexes as novel photosensitizers had drawn attention due to its high selectivity towards cancer cells and low toxicity to normal cells. Herein, we synthesized a lysosome-targeted polypyridyl ruthenium complex Rhein-Ru(bpy)3 (bpy = 2,2'-bipyridine, rhein = 4,5-dihydroxy-9,10-dioxoanthracene-2-carboxylic acid), tethering with the Chinese medicine herb rhein. Rhein-Ru(bpy)3 exhibited high phototoxicity with short time of irradiation against tumor cell lines with the IC50 value of 2.4- 8.7 µM, and higher cytotoxicity against cisplatin-resistant A2780 cell lines, suggesting that Rhein-Ru(bpy)3 could overcome the cisplatin resistance. Moreover, Rhein-Ru(bpy)3 displayed low cytotoxicity towards cell lines in dark incubation, which was beneficial to reduce the toxic side effects towards normal cell lines. Besides, the confocal imaging and western blotting assay results suggested that Rhein-Ru(bpy)3 could induce cancer cell death through the autophagy pathway. These results inspired us that lysosome-targeted photosensitizers based on ruthenium complexes showed great potential for photodynamic therapy (PDT) application in cancer treatment.

A Dinuclear Ruthenium(II) Complex Excited by Near-Infrared Light through Two-Photon Absorption Induces Phototoxicity Deep within Hypoxic Regions of Melanoma Cancer Spheroids.

The dinuclear photo-oxidizing RuII complex [{Ru(TAP2)}2(tpphz)]4+ (TAP = 1,4,5,8- tetraazaphenanthrene, tpphz = tetrapyrido[3,2-a:2',3'-c:3″,2''-h:2‴,3'''-j]phenazine), 14+, is readily taken up by live cells localizing in mitochondria and nuclei. In this study, the two-photon absorption cross section of 14+ is quantified and its use as a two-photon absorbing phototherapeutic is reported. It was confirmed that the complex is readily photoexcited using near-infrared, NIR, and light through two-photon absorption, TPA. In 2-D cell cultures, irradiation with NIR light at low power results in precisely focused phototoxicity effects in which human melanoma cells were killed after 5 min of light exposure. Similar experiments were then carried out in human cancer spheroids that provide a realistic tumor model for the development of therapeutics and phototherapeutics. Using the characteristic emission of the complex as a probe, its uptake into 280 µm spheroids was investigated and confirmed that the spheroid takes up the complex. Notably TPA excitation results in more intense luminescence being observed throughout the depth of the spheroids, although emission intensity still drops off toward the necrotic core. As 14+ can directly photo-oxidize DNA without the mediation of singlet oxygen or other reactive oxygen species, phototoxicity within the deeper, hypoxic layers of the spheroids was also investigated. To quantify the penetration of these phototoxic effects, 14+ was photoexcited through TPA at a power of 60 mW, which was progressively focused in 10 µm steps throughout the entire z-axis of individual spheroids. These experiments revealed that, in irradiated spheroids treated with 14+, acute and rapid photoinduced cell death was observed throughout their depth, including the hypoxic region.

Definition of the Interaction Domain and Electron Transfer Route between Cytochrome c and Cytochrome Oxidase.

The reaction between cytochrome c (Cc) and cytochrome c oxidase (CcO) was studied using horse cytochrome c derivatives labeled with ruthenium trisbipyridine at Cys 39 (Ru-39-Cc). Flash photolysis of a 1:1 complex between Ru-39-Cc and bovine CcO at a low ionic strength resulted in the electron transfer from photoreduced heme c to CuA with an intracomplex rate constant of k3 = 6 × 104 s-1. The K13A, K72A, K86A, and K87A Ru-39-Cc mutants had nearly the same k3 value but bound much more weakly to bovine CcO than wild-type Ru-39-Cc, indicating that lysines 13, 72, 86, and 87 were involved in electrostatic binding to CcO, but were not involved in the electron transfer pathway. The Rhodobacter sphaeroides (Rs) W143F mutant (bovine W104) caused a 450-fold decrease in k3 but did not affect the binding strength with CcO or the redox potential of CuA. These results are consistent with a computational model for Cc-CcO (Roberts and Pique ( 1999 ) J. Biol. Chem. 274 , 38051 - 38060 ) with the following electron transfer pathway: heme c → CcO-W104 → CcO-M207 → CuA. A crystal structure for the Cc-CcO complex with the proposed electron transfer pathway heme c → Cc-C14 → Cc-K13 → CcO-Y105 → CcO-M207 → CuA ( S. Shimada ( 2017 ) EMBO J. 36 , 291 - 300 ) is not consistent with the kinetic results because the K13A mutation had no effect on k3. Addition of 40% ethylene glycol (as present during the crystal preparation) decreased k3 significantly, indicating that it affected the conformation of the complex. This may explain the discrepancy between the current results and the crystallographic structure.

Determination of Proton-Coupled Electron Transfer Reorganization Energies with Application to Water Oxidation Catalysts.

The reorganization energy, λ, for interfacial electron transfer (ET) and for proton-coupled electron transfer (PCET) between a water oxidation catalyst and a conductive In2O3:Sn (ITO) oxide were extracted from kinetic data by application of Marcus-Gerischer theory. Specifically, light excitation of the water oxidation catalyst [RuII(tpy)(4,4'-(PO3H2)2-bpy)OH2]2+ (RuII-OH2), where tpy is 2,2':6',2″-terpyridine and bpy is 2,2'-bipyridine, anchored to a mesoporous thin film of ITO nanocrystallites resulted in rapid excited-state injection ( kinj > 108 s-1). The subsequent reaction of the injected electron (ITO(e-)) and the oxidized catalyst was quantified spectroscopically on nanosecond and longer time scales. The metallic character of ITO allowed potentiostatic control of the reaction free energy change -Δ Go over a 1 eV range. At pH values below the p Ka = 1.7 of the oxidized catalyst, ET was the primary reaction. Within the pH range 2 ≤ pH ≤ 5, an interfacial PCET reaction (ITO(e-) + RuIII-OH + H+→ RuII-OH2) occurred with smaller rate constants. Plots of the rate constants versus -Δ Go provided a reorganization energy of λPCET = 0.9 eV and λET = 0.5 eV. A second water oxidation catalyst provided similar values and demonstrated generality. The utilization of conductive oxides is shown to be a powerful tool for quantifying PCET reorganization energies at oxide surfaces for the first time.

Two novel BODIPY-Ru(ii) arene dyads enabling effective photo-inactivation against cancer cells.

BODIPY (boron dipyrromethene) derivatives and Ru(ii) complexes are two types of functional compounds that have found wide applications in the fields of biology and medicine. We herein synthesized two new Ru(ii) arene complexes based on an iodized BODIPY-containing pyridine (py-I-BODIPY) ligand, [(p-cym)Ru(bpy)(py-I-BODIPY)](2+) (2) and [(p-cym)Ru(2-pydaT)(py-I-BODIPY)](2+) (3), where p-cym = para-cymene, bpy = 2,2'-bipyridine, and 2-pydaT = 2,4-diamino-6-(2-pyridyl)-1,3,5-triazine. The photophysical, photochemical and photobiological properties of 2 and 3 were compared with that of [(p-cym)Ru(bpy)(py-BODIPY)](2+) (1). While 1 undergoes efficient monodentate ligand dissociation upon visible light irradiation and therefore may photobind DNA as a potential photoactivated chemotherapy (PACT) agent, 2 and 3 can generate (1)O2 effectively and thus may serve as photosensitizers in photodynamic therapy (PDT). In electrophoresis experiments, 2 and 3 are even able to retard the mobility of plasmid DNA in the dark at high concentrations. More importantly, the cytotoxicities of 2 and 3 against human ovarian adenocarcinoma SKOV3 cells are enhanced about ten times under irradiation, leading to cytotoxicities more than one order of magnitude higher than that of cisplatin, demonstrating an efficient hybridization of the iodized BODIPY chromophore and the Ru(ii) arene complex.

Photocatalytic metal-organic frameworks for the aerobic oxidation of arylboronic acids.

A photocatalytic Ru complex was incorporated into a Zr(iv)-based metal-organic framework (MOF) via postsynthetic methods. The resulting UiO-67-Ru(bpy)3 shows efficient and recyclable catalytic activity for the aerobic oxidation of arylboronic acids under near-UV and visible light irradiation.

Transmission of photo-catalytic function in a self-replicating chemical system: in situ amphiphile production over two protocell generations.

Glass microsphere supported protocells were built to investigate the transmission of catalytic function during replication. The chemical system's replication was driven through in situ amphiphile production that resulted in the formation of free bilayers, the system's second "generation". It was demonstrated that both generations, once separated, still exhibited the ability to convert amphiphile precursors. This result shows that transmission of function in chemical systems is possible during self-replication.

Production of reactive oxygen and nitrogen species by light irradiation of a nitrosyl phthalocyanine ruthenium complex as a strategy for cancer treatment.

Production of reactive oxygen species has been used in clinical therapy for cancer treatment in a technique known as Photodynamic Therapy (PDT). The success of this therapy depends on oxygen concentration since hypoxia limits the formation of reactive oxygen species with consequent clinical failure of PDT. Herein, a possible synergistic effect between singlet oxygen and nitric oxide (NO) is examined since this scenario may display increased tumoricidal activity. To this end, the trinuclear species [Ru(pc)(pz)2{Ru(bpy)2(NO)}2](PF6)6 (pc = phthalocyanine; pz = pyrazine; bpy = bipyridine) was synthesized to be a combined NO and singlet oxygen photogenerator. Photobiological assays using at 4 × 10(-6) M in the B16F10 cell line result in the decrease of cell viability to 21.78 ± 0.29% of normal under light irradiation at 660 nm. However, in the dark and at the same concentration of compound , viability was 91.82 ± 0.37% of normal. The potential application of a system like in clinical therapy against cancer may be as an upgrade to normal photodynamic therapy.

Efficient chemical and visible-light-driven water oxidation using nickel complexes and salts as precatalysts.

Chemical and visible-light-driven water oxidation catalyzed by a number of Ni complexes and salts have been investigated at pH 7-9 in borate buffer. For chemical oxidation, [Ru(bpy)3](3+) (bpy = 2,2'-bipyridine) was used as the oxidant, with turnover numbers (TONs) >65 and a maximum turnover frequency (TOFmax) >0.9 s(-1). Notably, simple Ni salts such as Ni(NO3 )2 are more active than Ni complexes that bear multidentate N-donor ligands. The Ni complexes and salts are also active catalysts for visible-light-driven water oxidation that uses [Ru(bpy)3](2+) as the photosensitizer and S2 O8 (2-) as the sacrificial oxidant; a TON>1200 was obtained at pH 8.5 by using Ni(NO3)2 as the catalyst. Dynamic light scattering measurements revealed the formation of nanoparticles in chemical and visible-light-driven water oxidation by the Ni catalysts. These nanoparticles aggregated during water oxidation to form submicron particles that were isolated and shown to be partially reduced ß-NiOOH by various techniques, which include SEM, energy-dispersive X-ray spectroscopy, X-ray photoelectron spectroscopy, XRD, and IR spectroscopy. These results suggest that the Ni complexes and salts act as precatalysts that decompose under oxidative conditions to form an active nickel oxide catalyst. The nature of this active oxide catalyst is discussed.

Ultrasound assisted, ruthenium-exchanged FAU-Y zeolite catalyzed alkylation of indoles with epoxides under solvent free conditions.

Ruthenium-exchanged FAU-Y zeolite (RuY) was used as a recyclable catalyst for regioselective ring-opening of epoxides with indoles under irradiation of sonic waves. It was found that a solvent free process, under the above mentioned conditions provides good yields of the desired 3-alkylated indole derivatives.

Photoactive ruthenium nitrosyls as NO donors: how to sensitize them toward visible light.

Nitric oxide (NO) can induce apoptosis (programmed cell death) at micromolar or higher doses. Although cell death via NO-induced apoptosis has been studied quite extensively, the targeted delivery of such doses of NO to infected or malignant tissues has not been achieved. The primary obstacle is indiscriminate NO release from typical systemic donors such as glycerin trinitrate: once administered, the drug travels throughout the body, and NO is released through a variety of enzymatic, redox, and pH-dependent pathways. Photosensitive NO donors have the ability to surmount this difficulty through the use of light as a localized stimulus for NO delivery. The potential of the method has prompted synthetic research efforts toward new NO donors for use as photopharmaceuticals in the treatment of infections and malignancies. Over the past few years, we have designed and synthesized several metal nitrosyls (NO complexes of metals) that rapidly release NO when exposed to low-power (milliwatt or greater) light of various wavelengths. Among them, the ruthenium nitrosyls exhibit exceptional stability in biological media. However, typical ruthenium nitrosyls release NO upon exposure to UV light, which is hardly suitable for phototherapy. By following a few novel synthetic strategies, we have overcome this problem and synthesized a variety of ruthenium nitrosyls that strongly absorb light in the 400-600-nm range and rapidly release NO under such illumination. In this Account, we describe our progress in designing photoactive ruthenium nitrosyls as visible-light-sensitive NO donors. Our research has shown that alteration of the ligands, in terms of (i) donor atoms, (ii) extent of conjugation, and (iii) substituents on the ligand frames, sensitizes the final ruthenium nitrosyls toward visible light in a predictable fashion. Density functional theory (DFT) and time-dependent DFT (TDDFT) calculations provide guidance in this "smart design" of ligands. We have also demonstrated that direct attachment of dye molecules as light-harvesting antennas also sensitize ruthenium nitrosyls to visible light, and TDDFT calculations provide insight into the mechanisms of sensitization by this technique. The fluorescence of the dye ligands makes these NO donors "trackable" within cellular matrices. Selected ruthenium nitrosyls have been used to deliver NO to cellular targets to induce apoptosis. Our open-design strategies allow the isolation of a variety of these ruthenium nitrosyls, depending on the choices of the ligand frames and dyes. These designed nitrosyls will thus be valuable in the future endeavor of synthesizing novel pharmaceuticals for phototherapy.

Photoinduced linkage isomerism of {RuNO}(6) complexes with bioligands and related chelators.

Five novel complexes containing the {RuNO}(6) fragment and the anions derived from l-histidine (l-his), rac-3-amino-alanine (rac-dap), kojic acid (koj), methyliminodiacetic acid (mida), and thiodiacetic acid (tda) have been synthesised and characterised by single-crystal X-ray diffraction analysis, mass spectrometry, spectroscopic methods (NMR, UV-vis, IR) and elemental analysis. In the irradiated complexes, [Ru(NO)Cl(2)(l-his)] (1), [Ru(NO)Cl(2)(rac-dap)] (2), K[Ru(NO)Cl(3)(koj)] (3), K[Ru(NO)Cl(2)(mida)].(1/2)H(2)O (4), and K[Ru(NO)Cl(2)(tda)].H(2)O (5), the existence of the photoinduced long-lived metastable isonitrosyl state S1 and/or the side-on-bonded S2 state were detected by differential scanning calorimetry (DSC) and/or IR spectroscopy. For all complexes 1-5 full geometry optimisation, frequency analysis and calculation of the isotropic magnetic shielding tensors have been conducted in the framework of DFT theory.

Chemical and optical control of peristaltic actuator based on self-oscillating porous gel.

We demonstrate the chemical and optical control of the self-sustaining peristaltic motion of a structural colored porous hydrogel.