Your browser doesn't support javascript.
loading
Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-990060
Biblioteca responsável: WPRO
ABSTRACT

Objective:

To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).

Methods:

Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed.

Results:

The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation.

Conclusions:

PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Texto completo: Disponível Base de dados: WPRIM (Pacífico Ocidental) Idioma: Chinês Revista: Chinese Journal of Applied Clinical Pediatrics Ano de publicação: 2023 Tipo de documento: Artigo
Texto completo: Disponível Base de dados: WPRIM (Pacífico Ocidental) Idioma: Chinês Revista: Chinese Journal of Applied Clinical Pediatrics Ano de publicação: 2023 Tipo de documento: Artigo
...