Advances in Dravet syndrome / 国际儿科学杂志

Dravet syndrome is a rare and severe developmental epileptic encephalopathy with variable clinical phenotypes.Dravet syndrome is difficult to diagnose and treat, and related comorbidities have a profound impact on the long-term quality of life of patients and their parents.SCN1A is the main pathogenic gene of Dravet syndrome, and SCN1A mutations are found in more than 85% of the patients.In recent years, with the development of genetic testing technology and the accumulation of cases, the understanding of the characteristics of epileptic seizures, comorbidities and SCN1A gene mutation characteristics in Dravet syndrome has gradually deepened.In addition to conventional antiepileptic drugs, new antiepileptic drugs(cannabidiol, fenfluramine)have also shown good antiepileptic effects and are expected to become second-line drugs for the treatment of Dravet syndrome seizures.This article mainly reviews the research progress of unique clinical phenotype, SCN1A gene mutation characteristics and new antiepileptic drugs of Dravet syndrome, in order to deepen clinicians′ understanding of the disease.

Relationship between mutation characteristics of SCN1A gene in Dravet syndrome and its clinical phenotype and drug efficacy / 中华实用儿科临床杂志

Objective To explore the relationship between different mutation characteristics and clinical phenotype of children with Dravet syndrome (DS) with SCN1A gene mutation,and to summarize the drug efficacy.Methods The clinical data of children diagnosed as DS from the Department of Pediatrics Neurology,the Third Affiliated Hospital of Zhengzhou University from January 2014 to May 2018 were collected.The peripheral blood DNA of the children was detected by adopting next generation sequencing for epilepsy-related gene-panel,while the parents' were screened by using Sanger sequencing for family verification.Multiple ligation-dependent probe amplification technology was used to detect large fragment variation of SCN1A gene if the mutations of the children were negative.The Gesell scale and cavity Wechsler intelligence scale for children(C-WISC) were used to evaluate the intelligence of children.Results A total of 50 cases of DS were collected,38 cases of them were positive for SCN1A mutation,and the mutation rate was 76.0％ (38/50 cases),of which,the missense mutation[50.0％ (19/38 cases)] and frameshift mutation[28.9％ (11/38 cases)] were dominant.The average onset age of 50 patients was 6 months,of which onset of seizures was triggered by fever(temperature ＞ 37.5 ℃) in 68.0％ (34/50 cases)of children,the history of seizures in hot baths was found in 60.0％ (30/50 cases) of children,status epilepticus was found in 74.0％ (37/50 cases),cluster-like episodes was found in 80.0％ (40/50 cases),≥2 seizure types was found in 92.0％ (46/50 cases).Mental retardation was found in most of the children,of which 30.0％ (15/50 cases) were mild mental retardation,38.0％ (19/50 cases) were moderate mental retardation,14.0％ (7/50 cases)were severe intelligence retardation.Interictal abnormalities of electroencephalogram(EEG) before 1 year old was found in 24.0％ (12/50 cases),and the average age of EEG abnormalities was 30.12 months old;the top three drug efficacy rates were 70.0％ (28/40 cases) of Topiramate,48.0％ (24/50 cases) of Sodium Valproate,45.7％ (16/35 cases) Clonazepam or Clobazam.The time of onset of myoclonus and atypical absence of the truncation mutation group was earlier than that of the missense mutation group(14.75 months vs.21.20 months;16.82 months vs.26.00 months),and the difference was statistically significant (P ＜ 0.05).The proportion of clustered episodes in the truncation mutation group was higher than that in the missense mutation group [94.7％ (18/19 cases)vs.63.2％ (12/19 cases)],and the difference was statistically significant (P ＜0.05).There was no significant correlation between the SCN1A gene mutation (type and position) and age of onset,type of seizure,proportion of convulsion persistence,the mental development or abnormal proportion of EEG and seizure frequency before 1 year old(all P ＞ 0.05).Conclusions The SCN1A gene mutation rate is high in children with DS,and the SCN1A gene mutation characteristics has a certain correlation with DS clinical phenotype.Topiramate is the most effective drug among children with DS.

Relationship between the single nucleotide polymorphisms of SCN1A genes and the therapeutic effects of carbamazepine in Zhuang population with epilepsies / 实用医学杂志

Objective To investigate the relationship between the single nucleotide polymorphisms of SCN1A genes and the therapeutic effects of carbamazepine in Zhuang population with epilepsies. Methods We used Mass ARRAY-IPLEX and matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) technology to detect the SCN1A gene rs4667869 and rs10497275 genotypes in peripheral blood of186 Zhuang individuals with epileptic (66 cases in effective group and 120 cases of ineffective group) who received the standardized treatment of carbamazepine in Baise Region. The reversed phase high-performance liquid chromatography was used to determine blood drug level of carbamazepine. The correlations between the genotypes, alleles and the carbamazepine efficacy of the two groups were evaluated, respectively. We also analyzed the difference of carbamazepine's blood concentration between different genotypes. Results Three genotypes of GG, GC and CC were detected in rs4667869 locus. There were 3 genotypes of GG, GA and AA found in rs 10497275 locus.The differences in the allele distribution (χ2 = 11.790, P = 0.001) and genotype distribution (χ2= 10.655, P =0.005) of the rs4667869 locus were statistically significant between the two groups (ineffective group vs. effective group). However, there was no significant difference in allele distribution (χ2 = 3.335, P= 0.068) and genotype (χ2= 3.046, P = 0.218) for rs 10497275 locus in these two groups. Compared with the GG + GC genotype, the CC genotype of rs4667869 locus significantly reduced the antiepileptic efficacy of carbamazepine (OR = 2.800, 95％CI : 1.495～5.244). W hile there were no significant differences in blood concentration of genotype CC (t=1.273, P = 0.083) comparing with genotypes GG + GC in rs4667869. No significant differences were found in blood concentration between genotype AA and genotypes GG + GA of rs 10497275 (t= 0.963, P = 0.064). Conclusions These results suggest that the single nucleotide polymorphisms of rs4667869 in SCN1A genes could be associated with the drug resistance of carbamazepine in Zhuang population with epilepsies.

Relationship between mutation characteristics of SCN1A gene in Dravet syndrome and its clinical phenotype and drug efficacy / 中华实用儿科临床杂志

Objective@#To explore the relationship between different mutation characteristics and clinical phenotype of children with Dravet syndrome (DS) with SCN1A gene mutation, and to summarize the drug efficacy.@*Methods@#The clinical data of children diagnosed as DS from the Department of Pediatrics Neurology, the Third Affi-liated Hospital of Zhengzhou University from January 2014 to May 2018 were collected.The peripheral blood DNA of the children was detected by adopting next generation sequencing for epilepsy-related gene-panel, while the parents′ were screened by using Sanger sequencing for family verification.Multiple ligation-dependent probe amplification technology was used to detect large fragment variation of SCN1A gene if the mutations of the children were negative.The Gesell scale and cavity Wechsler intelligence scale for children(C-WISC) were used to evaluate the intelligence of children.@*Results@#A total of 50 cases of DS were collected, 38 cases of them were positive for SCN1A mutation, and the mutation rate was 76.0%(38/50 cases), of which, the missense mutation[50.0%(19/38 cases)] and frameshift mutation[28.9%(11/38 cases)] were dominant.The average onset age of 50 patients was 6 months, of which onset of seizures was triggered by fever(temperature>37.5 ℃) in 68.0%(34/50 cases)of children, the history of seizures in hot baths was found in 60.0%(30/50 cases) of children, status epilepticus was found in 74.0%(37/50 cases), cluster-like episodes was found in 80.0%(40/50 cases), ≥2 seizure types was found in 92.0%(46/50 cases). Mental retarda-tion was found in most of the children, of which 30.0% (15/50 cases) were mild mental retardation, 38.0% (19/50 cases) were moderate mental retardation, 14.0% (7/50 cases)were severe intelligence retardation.Interictal abnormalities of electroencephalogram(EEG) before 1 year old was found in 24.0%(12/50 cases), and the average age of EEG abnormalities was 30.12 months old; the top three drug efficacy rates were 70.0% (28/40 cases) of Topiramate, 48.0% (24/50 cases) of Sodium Valproate, 45.7% (16/35 cases) Clonazepam or Clobazam.The time of onset of myoclonus and atypical absence of the truncation mutation group was earlier than that of the missense mutation group(14.75 months vs.21.20 months; 16.82 months vs.26.00 months), and the difference was statistically significant(P<0.05). The proportion of clustered episodes in the truncation mutation group was higher than that in the missense mutation group [94.7%(18/19 cases)vs.63.2%(12/19 cases)], and the difference was statistically significant (P<0.05). There was no significant correlation between the SCN1A gene mutation (type and position) and age of onset, type of seizure, proportion of convulsion persistence, the mental development or abnormal proportion of EEG and seizure frequency before 1 year old(all P>0.05).@*Conclusions@#The SCN1A gene mutation rate is high in children with DS, and the SCN1A gene mutation characteristics has a certain correlation with DS clinical phenotype.Topiramate is the most effective drug among children with DS.

SCN1A Variants in Patients with Dravet Syndrome / 대한소아신경학회지

PURPOSE: The aim of this study is to examine the SCN1A variants in Korean patients with Dravet syndrome. METHODS: We conducted a retrospective study of clinically confirmed thirty-nine patients with Dravet syndrome who visit our hospital from January 2007 to May 2015. We analyzed the SCN1A variants by direct sequencing. We analyzed and classified SCN1A variants according to ACMG/AMP (American College of Medical Genetics and Genomics and the Association for Molecular Pathology) guideline. RESULTS: A total thirty-nine patients (female 22, male 17) were included. Among them, twenty patients (51.2%) with Dravet syndrome had pathogenic or likely pathogenic SCN1A mutations including fifteen truncating mutations (12 nonsense and 3 splice region mutations), 5 missense mutations. The remained variants in nineteen patients with Dravet syndrome classified into ten variants of unknown significances, and 9 benign variants. In our study, truncation mutations are located whole span of SCN1A protein, while half of missense mutations are located at higher density on pore loop (S5-S6) regions. CONCLUSION: Unlike previous known study, lower positive rate of SCN1A mutation of Dravet syndrome was revealed in our study. The importance of parental test (trio test) and other additional tests have been emphasized.

SCN1A Variants in Patients with Dravet Syndrome / 대한소아신경학회지

PURPOSE: The aim of this study is to examine the SCN1A variants in Korean patients with Dravet syndrome. METHODS: We conducted a retrospective study of clinically confirmed thirty-nine patients with Dravet syndrome who visit our hospital from January 2007 to May 2015. We analyzed the SCN1A variants by direct sequencing. We analyzed and classified SCN1A variants according to ACMG/AMP (American College of Medical Genetics and Genomics and the Association for Molecular Pathology) guideline. RESULTS: A total thirty-nine patients (female 22, male 17) were included. Among them, twenty patients (51.2%) with Dravet syndrome had pathogenic or likely pathogenic SCN1A mutations including fifteen truncating mutations (12 nonsense and 3 splice region mutations), 5 missense mutations. The remained variants in nineteen patients with Dravet syndrome classified into ten variants of unknown significances, and 9 benign variants. In our study, truncation mutations are located whole span of SCN1A protein, while half of missense mutations are located at higher density on pore loop (S5-S6) regions. CONCLUSION: Unlike previous known study, lower positive rate of SCN1A mutation of Dravet syndrome was revealed in our study. The importance of parental test (trio test) and other additional tests have been emphasized.

SCN1A Gene Mutation and Adaptive Functioning in 18 Vietnamese Children with Dravet Syndrome

BACKGROUND AND PURPOSE: Dravet syndrome is a rare and severe type of epilepsy in infants. The heterogeneity in the overall intellectual disability that these patients suffer from has been attributed to differences in genetic background and epilepsy severity. METHODS: Eighteen Vietnamese children diagnosed with Dravet syndrome were included in this study. SCN1A variants were screened by direct sequencing and multiplex ligation-dependent probe amplification. Adaptive functioning was assessed in all patients using the Vietnamese version of the Vineland Adaptive Behavior Scales, and the results were analyzed relative to the SCN1A variants and epilepsy severity. RESULTS: We identified 13 pathogenic or likely pathogenic variants, including 6 that have not been reported previously. We found no correlations between the presence or type of SCN1A variants and the level of adaptive functioning impairment or severity of epilepsy. Only two of nine patients aged at least 5 years had an adaptive functioning score higher than 50. Both of these patients had a low frequency of convulsive seizures and no history of status epilepticus or prolonged seizures. The remaining seven had very low adaptive functioning scores (39 or less) despite the variability in the severity of their epilepsy confirming the involvement of factors other than the severity of epilepsy in determining the developmental outcome. CONCLUSIONS: Our study expands the spectrum of known SCN1A variants and confirms the current understanding of the role of the genetic background and epilepsy severity in determining the developmental outcome of Dravet syndrome patients.

Lack of meaningful genotype-phenotype association in SCN1A-related infantile-onset epileptic encephalopathies

Background & Objective: SCN1A gene which encodes for sodium channel alpha 1 subunit has been found to be the most common mutated gene in patients with epilepsy. This study aims to characterize the SCN1A mutations as well as to describe genotype and phenotype association in children with SCN1Arelated infantile-onset epileptic encephalopathies in Malaysia. Methods: Children with infantile-onset epileptic encephalopathy mostly suspected to have Dravet syndrome who had mutational analysis for SCN1A gene from hospitals all over Malaysia were included in the study. Their epilepsy syndrome diagnosis was classified into severe myoclonic epilepsy in infancy and its variants. Polymerase chain reaction and bidirectional sequencing were used to identify SCN1A mutations. Results: A total of 38 children with heterozygous mutations were analysed, 22 (57.9%) of which were novel mutations. Truncated mutations were the most common mutation type (19, 50%). Other mutation types were missense mutations (14, 36.8%), splice site mutations (4, 10.5%) and in-frame deletion (1, 2.6%). The mean age of seizure onset was 4.7 months. Seizure following vaccination was observed in 26.3% of the children. All of them had drug resistant epilepsy. There was no significant association between the type of mutation with the syndromic diagnosis, age of seizure onset, tendency of the seizures to cluster or having status epilepticus, mean age when developmental delay was observed and response to various antiepileptic drugs. Conclusion: This study expands the spectrum of SCN1A mutations and proves the importance of SCN1A gene testing in diagnosing infantile-onset epileptic encephalopathies patients. Although, our study does not support any clinically meaningful genotype-phenotype association for SCN1A-related infantile-onset epileptic encephalopathies, the clinical characteristics of our cohort are similar to those that have been described in previous studies.

Role of SCN1A gene variations in the development of familial febrile seizures / 临床儿科杂志

Objective To determine the role of SCN1A gene variation in the development of familial febrile seizures (FS).Methods Clinical data were collected from 8 familial FS pedigrees, and peripheral venous blood samples were collected from the probands and other available family members. All 26 coding exons and exon-intron boundaries at least 50 bases of the human SCN1A gene were amplifled by polymerase chain reaction, the products were subsequently sequenced. To novo variation, other family members were screened for the corresponding exons. Two hundred age-matched healthy children were served as normal controls. ResultsA total of 33 variations in the SCN1A gene were identifled in these families. Of these variations, one was a missense mutation; the remaining 32 variations were previously submitted as single nucleotide polymorphisms (SNPs). A c.2650G>A heterozygous missense mutation in exon 15 of the SCN1A gene found in the proband of family 4 was inherited from his father who had seizures with fever in early childhood. The c.2650G>A mutation was absent in the 400 alleles of normal controls. To the best of our knowledge, the SCN1A c.2650G>A mutation has neither been reported in the NCBI SNP database nor in the literature to date. The c.2650G>A mutation changes a glycine at amino acid 884 in the SCN1A protein to a serine (p.Gly884Ser). Protein sequence analysis showed that the p.Gly884Ser is located at a highly conserved region between the 4th and 5th transmembrane segment of the homologous domain Ⅱ of voltage-gated sodium channel 1 subunit (DIIS4-S5). ConclusionsThe pathogenesis of familial febrile seizures was related to the SCN1A variation, the mutation outside the region of the voltage sensor (S4) and ion channel pore (S5-S6) of the voltage gated sodium channelα-subunit may be an important factor to cause mild phenotype epilepsy syndrome.

Mutation screening of SCN1A 3′ untranslated region on Dravet syndrome patients and functional analysis of the variant / 中华神经科杂志

Objective To conduct mutation screening of SCN1A 3′ untranslated region (UTR) on Dravet syndrome (DS) patients without mutations in the SCN1A coding region and promoter region, and functional analysis of the variant from DS patients.Methods Twenty-eight DS patients without mutations in the SCN1A coding region and promoter region were screened for SCN1A 3′ UTR mutations using PCR and direct sequencing.Functional analysis of the detected mutation was done via luciferase assay, mRNA stability analysis and RNA electrophoretic mobility shift assay (RNA-EMSA).Results A novo variant (c.*20A>G) in SCN1A 3′ UTR was found in one DS patient.The variant (c.*20A>G) reduced the luciferase gene xpression by 30% through increasing the affinity of pluripotent embryonal carcinoma cell line NT2/cytoplasmic protein binding and reducing luciferase gene mRNA stability (t=8.5,P<0.01).Conclusions A functional variant was detected from one patient with DS.This variant negatively regulated the gene expression by increasing the affinity of pluripotent embryonal carcinoma cell line NT2/cytoplasmic protein binding and reducing mRNA stability.

Study on mosaicism of SCN1A gene mutation in parents of children with Dravet syndrome / 中华儿科杂志

Objective@#To investigate the clinical phenotypes and the mutant allele proportion of parents with SCN1A gene mutation mosaicism of Dravet syndrome (DS) children, thus to provide guidance for family reproduction and prenatal diagnosis.@*Method@#The clinical data and peripheral blood DNA samples of DS patients with a SCN1A gene mutation proved by Sanger sequencing were collected prospectively from February 2005 to November 2016 in Department of Pediatrics, Peking University First Hospital. The same mutation was searched in parents and other available relatives. Parental somatic mosaicism was confirmed and quantified by Ion Torrent Personal Genome Machine (PGM) and Raindrop droplet digital PCR (ddPCR). The families were followed up and prenatal diagnosis was provided.@*Result@#Mosaicisms of SCN1A gene mutation in parents were identified in 5.2% (30 out of 575) DS families. Seventeen were fathers and thirteen were mothers. The mutant allele proportion ranged from 1.7% to 32.9% by PGM and from 0.82% to 34.51% by ddPCR, respectively. In 30 parents with somatic mosaicism, thirteen were asymptomatic, ten had a history of febrile seizures (FS), five with epilepsy, one with febrile seizure plus and one had a history of afebrile seizure. Four families had two children with DS. Three siblings of the probands were confirmed genetically with the same pathogenic mutation. One deceased sister of the proband was assumed to have the same pathogenic mutation because she matched DS diagnosis after medical history review despite no blood sample. Two families received prenatal diagnosis. One second pregnancy was terminated because the fetus inherited the mutation as the mother's wish.@*Conclusion@#Sanger sequencing detects parents of some children with DS are SCN1A mutation mosaics. PGM and ddPCR can be used for accurate quantification of mutant mosaics, which can provide accurate guidance for family genetic counseling.

SCN1A gene variation and related epilepsy syndrome / 国际儿科学杂志

Among the genes involved in epilepsy,the SCN1 A gene represents one of the most commonly mutated human epilepsy genes, refers to be as super culprit gene, SCN1 A mutations cause epilepsy phenotype heterogeneity, diversity of clinical manifestations, the light performance of febrile seizures, it shows severe infant severe myoclonic epilepsy.By retrieving SCN1 A in gene mutation database, about 900 gene mutatation are associated with epilepsy syndrome.This article reviews the importance of SCN1 A gene mutation associates with epilepsy syndrome,and the importance of genetic screening SCN1 A.

¿Crisis febriles complejas o síndrome de Dravet?: Descripción de 3 casos clínicos / Complex febrile Seizures or Dravet syndrome?: Description of 3 case reports

Introduction: Dravet syndrome (DS) is one of the most intractable forms of epilepsy that begins in infancy. This syndrome is characterized by beginning with complex febrile seizures (FS) in a healthy infant and progresses to refractory epilepsy with psychomotor regression. The detection of a SCN1A mutation encoding the sodium channel can confirm the diagnosis. Objective: To report 3 confirmed cases of genetically DS. Case reports: We describe 3 girls diagnosed with complex FS that started when they were between 2 and 7 months old. FS were frequent, hemi generalized and myoclonic associated with recurrent febrile status epilepticus (SE). Despite FS and SE recurrence, the psychomotor development, electrophysiological studies and magnetic resonance imaging (MRI) of the brain were normal. After a year, they developed afebrile seizures progressing to refractory epilepsy with developmental regression. A molecular study detected SCN1A mutation confirming DS. The specific antiepileptic treatment and prevention of febrile episodes allowed partial control of epilepsy with some recovery of psychomotor skills. Conclusions: The high frequency complex FS associated with recurrent SE in a previously healthy infant should alert about the possibility of DS. Molecular diagnostics helps us to establish a drugs and non-drug therapies treatment, as well as long-term prognosis and genetic counseling.

Introducción: El Síndrome de Dravet (SD) es una de las formas más intratables de epilepsia que debuta en lactantes con convulsiones febriles (CF) complejas recurrentes que evolucionan posteriormente a epilepsia refractaria con regresión psicomotora. La detección de una mutación del canal de Sodio (SCN1A) permite certificar el diagnóstico. Objetivo: Reportar 3 casos de SD confirmados genéticamente. Casos clínicos: Se describen 3 niñas con diagnóstico de CF complejas iniciadas entre los 2 y 7 meses de edad. Las CF eran frecuentes, hemigeneralizadas, mioclónicas asociadas a status epilepticus (SE) febriles recurrentes. A pesar de la recurrencia de CF y SE, tanto el desarrollo psicomotor como los estudios electrofisiológicos y la resonancia magnética (RM) cerebral, fueron normales. Posterior al año iniciaron crisis afebriles que evolucionaron a epilepsia refractaria con regresión del desarrollo. El estudio molecular detectó la mutación SCN1A confirmando SD. El tratamiento antiepiléptico específico y la prevención de cuadros febriles permitieron un control parcial de la epilepsia con recuperación de algunas habilidades psicomotoras. Conclusiones: La alta frecuencia de CF complejas asociadas a SE recurrentes en un lactante previamente sano, debe alertar sobre la posibilidad de un SD. El diagnóstico molecular nos permite instaurar un tratamiento antiepiléptico y terapias no farmacológicas además de un pronóstico a largo plazo y consejería genética.

Correlation analysis of clinic and SCN1A mutation in febrile seizures plus with autism / 实用医学杂志

Objective To study the clinical characteristics of autism in febrile seizures plus (FS+) and the relationship between autism and SCN1A mutation. Methods Clinical data of 103 patients with FS+ treated in epilepsy centre of the Second Affiliated Hospital of Guangzhou Medical University were collected and analyzed. According to the international criteria, generalized epilepsy with febrile seizures plus (GEFS+), partial seizures with febrile seizures plus (PEFS+), Dravet syndrome (DS) and autism were diagnosed. Genomic DNA was obtained from blood samples. SCN1A were PCR amplified and mutations were detected by DHPLC and sequencing. Result Mental retardation was found in 53.8%of patients with GEFS+, 69.2%of patients with PEFS+, and all patients with DS, respectively. One in GEFS+, one in PEFS+and nine in DS patients were accompanied with autism (P<0.01). Among FS+patients with autism, one SCN1A mutation was found in PEFS+patients, while six SCN1A mutations were found in DS patients. Conclusions Majority of GEFS+and PEFS+patients showed mental retardation, while all the DS patients were accompanied with retardation. The occurrence of autism with DS is higher than GEFS+and PEFS+. No definite relationship between autism and SCN1A mutation was indicated.

Screening of SCN1A gene mutation in 10 families with generalized epilepsy accompanied by febrile seizure / 解放军医学杂志

Objective To analyze the phenotypes and to identify SCN1A gene mutation in families with generalized epilepsy accompanied by febrile seizures (GEFS+). Methods The clinical data were collected, and genomic DNA was extracted from peripheral blood lymphocytes of the proband and available members in the GEFS+ families. The phenotypes of the related members were analyzed. The coding regions and flanking intronic regions of the SCN1A gene were screened for mutations using PCR and direct DNA sequencing. Results Thirty-three related members from 10 GEFS+ families, ranged from 2 to 7 members in each family received the examination. T heir phenotypes included febrile seizures (FS) in 11 persons (33.3%), febrile seizures plus (Fs+) in 11 (33.3%), FS with partial seizures in 1 (3.0%), afebrile generalized tonic-clonic seizures (AGTCS) in 3 (9.1%), Dravet syndrome in 1 (3.0%), childhood absence epilepsy in 1 (3.0%), and unclassified seizures in 5 members (15.2%). SCN1A mutations were found in 3 families, including one family with missense mutation (glu1444-lys), and silent mutation: synonymous mutation existed in exon 15 (c.2592G>A), with synonymous mutation in exon 9 (c.1212 G>A) and exon 26 (c.5385 G>A) in two families. Conclusions A new missense mutation and three synonymous mutation have been found in the coding regions of SCN1A gene in three families. One of the families has synonymous mutation in two exons. Genetic mechanism is complicated in GEFS families.

Gen SCN1A, Epilepsias Genéticas (Sindrome de DRAVET), Correlato Genotipo / Fenotipo / The SCN1A gene, congenital epilepsies (Dravet syndrome), genotype/phenotype correlations

Las mutaciones del Gen SCN1A están asociadas a varios síndromes epilépticos con presentaciones clínicas superpuestas y de variable severidad a saber: Epilepsia Severa Mioclonica de la Infancia o Síndrome de Dravet,Epilepsia Generalizada con Convulsiones Febriles Plus, formas más leves de Sindrome de Dravet, la Epilepsia Intratable con Convulsiones Generalizadas Tonico-Clonicas y raros casos de Migraña familiar. Todas estas formas clínicas representan el 90% de los casos de mutación del gen SCN1A; recientemente se han incluido la Epilepsia Focal y Generalizada Criptogenética, la Mioclónica–Astática, formas del Síndrome de Lennox-Gastaut y la forma severa de Epilepsia Multifocal Infantil (Epilepsia Migratoria o Multifocal Severa de la Infancia). El objetivo de la presentación de estos tres casos de Epilepsia Refractaria Precoz es enfatizar los Fenotipos variables en la evolución de la semiología convulsiva, y del compromiso cognitivo, asociado a genotipos variables (compromiso de alelos diferentes en el mismo Gen). Se debe sospechar compromiso del Gen SCN1A en toda Encefalopatía Epiléptica con convulsiones febriles de comienzo en el 1er año de vida repetidas, en muchas ocasiones, prolongadas o en ramilletes, refractarias al tratamiento médico, con neuroimagenes y EEG normales en el inicio del trastorno convulsivo aunque la regresión psicomotora ocurra años después o las mioclonias estén ausentes y en quienes la vulnerabilidad a la fiebre o a los estados infecciosos leves precipitan convulsiones

Mutations in the SCN1A gene are associated with different epi-lepsy syndromes with overlapping clinical presentations and of variable severity, such as severe myoclonic epilepsy in infancy or Dravet syndrome, generalized epilepsy with febrile seizures plus, milder forms of Dravet syndrome, refractory epilepsy with generalized tonic-clonic seizures, and rare cases of familial migraine. In 90% of all these clinical presentations SCN1A mutations are found. More recently, cryptogenic focal and ge-neralized epilepsy, myoclonic–astatic epilepsy, different types of Lennox-Gastaut syndrome, and the severe form of infantile multifocal epilepsy (migrating partial seizures or severe infanti-le multifocal epilepsy) have also been included. The aim of the presentation of these three cases of early refractory epilepsy was to emphasize the variable phenotypes in the evolution of seizure semiology and the cognitive involvement associated with variable genotypes (involvement of different alleles of the same gene). SCN1A-gene involvement should be suspected in the face of all epileptic encephalopathies...

Single Nucleotide Polymorphisms of SCN1A-exon 9 in GEFS+ / 대한소아신경학회지

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.

Single Nucleotide Polymorphisms of SCN1A-exon 9 in GEFS+ / 대한소아신경학회지

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.

Mutations of SCN1A in Familial Febrile Seizures / 대한소아신경학회지

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.

Mutations of SCN1A in Familial Febrile Seizures / 대한소아신경학회지

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.