Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Clinical characteristics and high-throughput sequencing analysis of genetic and metabolic infantile cholestatic hepatopathy / 中华实用儿科临床杂志

Objective:To investigate the clinical and genetic characteristics of genetic and metabolic infantile cholestatic hepatopathy (ICH), and to provide evidence for its diagnosis and treatment.Methods:Clinical data and follow-up outcomes of hospitalized children diagnosed with ICH in the Department of Gastroenterology, Children′s Hospital, Capital Institute of Pediatrics from January 2014 to December 2019 were retrospectively analyzed.Among the 80 children, 27 were female and 53 were male, with a mean age of onset of (39±18) days old.Children with confirmed etiology by high-throughput sequencing analysis were included in the genetic metabolic group (44 cases), and those with idiopathic neonatal cholestasis(INC) of unknown etiology after the systematic examination were included in the INC group (36 cases). The t-test or independent sample rank sum test was used to compare the laboratory test results and biochemical indexes.The infection rate of cytomegalovirus was compared by the Chi- square test. Results:(1) A total of 80 cases were included, and 44 cases (55.0%)were confirmed as INC by high-throughput sequencing.Among those with a positive molecular diagnosis, there were 23 cases of citrin deficiency (CD), 10 cases of Alagille syndrome (ALGS), 6 cases of progressive familial intrahepatic cholestasis (PFIC), 2 cases of congenital bile acid synthesis defect, 2 cases of Nieman Pick disease, and 1 case of cystic fibrosis.(2) Serum total bile acid (TBA) and activated partial prothrombin time (APTT) levels in the genetic metabolic group were significantly higher than those in the INC group (all P<0.05). TBA and APTT levels in genetic metabolites were 180.6 (115.5, 271.6) μmol/L and 40.6 (37.1, 45.2) s, respectively, which were 123.3 (98.8, 163.4) μmol/L and 34.8 (31.7, 40.1) s in INC group, respectively.There was no significant difference in the cytomegalovirus infection rate between the 2 groups ( P>0.05). (3)The pathological examination of liver tissue in the genetic metabolic group was worse than that in the INC group, with spot-like and fusion focal-like necrosis, and 5 cases (4 cases of ALGS and 1 case of CD) showed a reduced number of bile ducts in the portal area and lumen stenosis. Conclusions:CD, ALGS and PFIC are the common causes of genetic and metabolic ICH.Fundamental cause of cholestasis should be actively examined in children with cytomegalovirus infection.High-throughput sequencing is of great significance in the accurate diagnosis of ICH.

Posttransplant epithelioid inflammatory myofibroblastic sarcoma: A case report

Epithelioid inflammatory myofibroblastic sarcoma (EIMS) is a rare entity and a novel variant of inflammatory myofibroblastic tumor (IMT), usually seen in children and nonsmoking young adults. Their occurrence in a posttransplant setting is still rare. These tumors are characterized by prominent epithelioid morphology, large histiocytoid “Reed Sternberg”-like cell, unique pattern of ALK immuno-reactivity, and aggressive clinical behavior. Their etiology and metastatic potential is controversial. In a post-transplant setting, many factors such as trauma, infections with EBV, HIV, Hepatitis C, mycobacteria, fungus, and chemotherapy-induced immunosuppression have been implicated in their etiology. We present the case of a 2-year-old female child who developed multiple omental and mesenteric tumor nodules, 8 months post liver transplant for progressive familial intrahepatic cholestasis (PFIC). Following a histopathological diagnosis of “mesenchymal neoplasm of possible malignant nature” on a trucut biopsy and frozen section, tumor debulking was performed. A final histological diagnosis of EMIS was made on the completely resected tumor. The patient remains in remission nearly 7 months after presentation, without any follow-up systemic chemotherapy. IMT after a solid organ transplant is rare, only 5 cases have been reported in the literature until now. Similar phenomenon has also been noted with hematopoietic stem cell transplant. However, to our knowledge, this case of EMIS in a post liver transplant patient is first of its kind.

Diagnosis and treatment of progressive familial intrahepatic cholestasis / 国际儿科学杂志

Progressive familial intrahepatic cholestasis ( PFIC) is a group of heterogenous autosomal recessive genetic diseases. PFIC resulted by genetic mutation which leading to bile metabolic disorder. The main manifestations are intrahepatic cholestasis, jaundice and pruritus. There are six subtype including PFIC1、PFIC2、 PFIC3 、PFIC4、 PFIC5 and PFIC6. PFIC4、 PFIC5 and PFIC6 are new subtypes. PFIC1、 PFIC2、PFIC3、PFIC4、 PFIC5 and PFIC6 caused by ATP8B1、 ABCB11、 ABCB4、 TJP2、 NR1H4 and MYO5B re-spectively. The diagnosis is mainly based on clinical manifestations, biochemical tests, liver histology and gene testing, etc. The treatment is divided into medical treatment of ursodeoxycholic acid, 4-phenylbutyrate acid, and surgical treatment of partial biliary diversion, liver transplantation, etc. This review summarizes the diagnosis and treatment of PFIC.

Progressive Familial Intrahepatic Cholestasis in Korea: A Clinicopathological Study of Five Patients

BACKGROUND: Progressive familial intrahepatic cholestasis (PFIC) is a heterogeneous group of autosomal recessive liver diseases that present as neonatal cholestasis. Little is known of this disease in Korea. METHODS: The records of five patients histologically diagnosed with PFIC, one with PFIC1 and four with PFIC2, by liver biopsy or transplant were reviewed, and ATP8B1 and ABCB11 mutation status was analyzed by direct DNA sequencing. Clinicopathological characteristics were correlated with genetic mutations. RESULTS: The first symptom in all patients was jaundice. Histologically, lobular cholestasis with bile plugs was the main finding in all patients, whereas diffuse or periportal cholestasis was identified only in patients with PFIC2. Giant cells and ballooning of hepatocytes were observed in three and three patients with PFIC2, respectively, but not in the patient with PFIC1. Immunostaining showed total loss of bile salt export pump in two patients with PFIC2 and focal loss in two. Lobular and portal based fibrosis were more advanced in PFIC2 than in PFIC1. ATP8B1 and ABCB11 mutations were identified in one PFIC1 and two PFIC2 patients, respectively. One PFIC1 and three PFIC2 patients underwent liver transplantation (LT). At age 7 months, one PFIC2 patient was diagnosed with concurrent hepatocellular carcinoma and infantile hemangioma in an explanted liver. The patient with PFIC1 developed steatohepatitis after LT. One patient showed recurrence of PFIC2 after 10 years and underwent LT. CONCLUSIONS: PFIC is not rare in patients with neonatal cholestasis of unknown origin. Proper clinicopathologic correlation and genetic testing can enable early detection and management.

The importance of inherited metabolic disease screening in the treatment and diagnosis of infantile cholestatic hepatopathy / 中国小儿急救医学

Objective To assess the significance of screening for inherited metabolic diseases in the treatment and diagnosis of infantile cholestatic hepatopathy,and to analyze the biochemical changed character‐istics of patients who were diagnosed with gene mutations. Methods From January 2016 to January 2017,69 children who were diagnosed as intrahepatic cholestasis in the Pediatric Gastroenterology Department of Shengjing Hospital Affiliated to China Medical University were enrolled. The medical history,physical exami‐nation,biochemical test and genetic metabolism screening results were recorded. Results Sixty‐seven cases of 69 children made tandem mass spectrometry(MS/MS),gas chromatography‐mass spectrometry(GC/MS) or genetic testing. Compared with the normal hereditary metabolic disease screening group, the abnormal group had higher levels of alkaline phosphatase,total bilirubin,direct bilirubin,and total bile acid,the differ‐ence was statistically significant (P<0. 05). The most common abnormal in MS/MS were elevation of free carnitines and arginine,citrulline,methionine,and the most common abnormal in GC/MS were elevation of 3‐hydroxyl propionic acid,4‐hydroxyl phenyllactic acid,4‐hydroxyl phenylacetic acid. In 6 children with posi‐tive genetic test results,the MS/MS and GC/MS of 4 neonatal intrahepatic cholestasis caused by citrin defi‐ciency showed aminoacidemia(citrullinemia,tyrosinemia) and elevations of urine organic acids. Five muta‐tions of SLC25A13 gene were found in the neonatal intrahepatic cholestasis caused by citrin deficiency pa‐tients,including IVS6+5G >A,851del4,IVS11 +1G >A,851 854de and 852 855del. The main clinical manifestations of progressive familial intrahepatic cholestasis type 2 ( PFIC2) were cholestatic jaundice and pruritus,γ‐glutamyl transpeptidase was normal,and with the c. 667C>T defection in the ABCB11 gene. The TALDO1 gene mutation type of one transaldolase deficiency was c. 716G>A and c. 854dupA heterozygous mutation. Conclusion MS/MS and GC/MS play a vital role in the early identification of cholestasis caused by genetic and metabolic disorders. Genetic testing can provide accurate diagnosis for rare genetic metabolic diseases.

A Rare BSEP Mutation Associated with a Mild Form of Progressive Familial Intrahepatic Cholestasis Type 2

ABSTRACT Progressive Familial Intrahepatic Cholestasis type 2 (PFIC2) is a rare cholestatic disorder diagnosed in infancy or childhood that can lead to severe hepatic fibrosis and liver failure. Mutations in the ABCB11 gene result in a deficiency of the bile salt export protein (BSEP) and accumulation of bile inside the hepatocytes. Hepatocellular carcinoma is another condition associated with severe forms of deletion mutations in the ABCB11 gene. Treatment options including ursodeoxycholic acid biliary diversion have mixed outcomes and some patients require liver transplantation. Here, we describe two siblings with an extremely mild form of PFIC2 inherited from heterozygous parents. The elder sibling had acute liver failure at the age of six months and both siblings had pruritus, cholestasis, coagulopathy and fat-soluble-vitamin deficiencies in infancy but have been asymptomatic past infancy. Genetic testing of the siblings revealed that each were compound heterozygotes for two missense mutations of the ABCB11 gene: p.C68Y and p.R832H. Medical treatment typical for PFIC2 has not been necessary for either patient. This is the first report of these variants following a mild course in two affected patients.(AU)

Colestasis intrahepática benigna recurrente, un reto diagnóstico / Recurrent Benign Intrahepatic Cholestasis is a Diagnostic Challenge

La colestasis hepática incluye una gran variedad de desórdenes que pueden comprometer la vía intra o extrahepática, requiriendo para su diagnóstico una asociación de hallazgos clínicos, bioquímicos, imagenológicos y en algunos casos, patológicos. Se describe el caso de un paciente que presenta episodios intermitentes y autoresolutivos de ictericia recurrente asociados con dolor abdominal y prurito intenso, en quien se encuentra durante los episodios de agudización un patrón colestásico intrahepático que se resuelve completamente durante los episodios de remisión.

Hepatic cholestasis includes a large variety of disorders which can compromise the intrahepatic and extrahepatic pathways. Diagnosis requires a combination of clinical, biochemical, imaging, and sometimes pathological, findings. We describe the case of a patient with intermittent episodes of jaundice which resolved by themselves but which were and decisive associated with abdominal pain and severe itching. These episodes occurred during exacerbation of the intrahepatic cholestatic pattern but completely resolved during episodes of remission.

Bipolar and Related Disorders Induced by Sodium 4-Phenylbutyrate in a Male Adolescent with Bile Salt Export Pump Deficiency Disease

Bile Salt Export Pump (BSEP) Deficiency disease, including Progressive Familial Intrahepatic Cholestasis type 2 (PFIC2), is a rare disease, usually leading within the first ten years to portal hypertension, liver failure, hepatocellular carcinoma. Often liver transplantation is needed. Sodium 4-phenylbutyrate (4-PB) seems to be a potential therapeutic compound for PFIC2. Psychiatric side effects in the adolescent population are little known and little studied since the drug used to treat children and infants. So we described a case of Caucasian boy, suffering from a late onset PFIC2, listed for a liver transplant when he was sixteen and treated with 4-FB (200 mg per kilogram of body weight per day). The drug was discontinued for the onset of bipolar and related disorders. This case illustrates possible psychiatric side effects of the drug.

A novel ABCB11 mutation in an Iranian girl with progressive familial intrahepatic cholestasis.

Progressive familial intrahepatic cholestasis is an autosomal recessive liver disorder caused by (biallelic) mutations in the ATP8B1 of ABCB11 gene. A nine‑year‑old girl with cholestasis was referred for genetic counseling. She had a family history of cholestasis in two previous expired siblings. Genetic analysis of the ABCB11 gene led to the identification of a novel homozygous mutation in exon 25. The mutation 3593‑ A > G lead to a missense mutation at the amino acid level (His1198Arg). This mutation caused PFIC2 due to abnormal function in the bile salt export pump protein (BSEP).

Cholecystoappendicostomy for Progressive Familial Intrahepatic Cholestasis.

We report a rare case of progressive familial intrahepatic cholestasis type 2 from India. The diagnosis was confirmed on the basis of gene mutation analysis. The child had intense pruritus refractory to conventional medical management. As liver biopsy did not reveal any cirrhosis, partial external biliary diversion was considered as an alternative to liver transplant. We performed cholecystoappendicostomy rather than the conventional method of using an ileal loop as a conduit between the gall bladder and abdominal wall. Child recovered completely.

Colestasias familiares: una causa común de hiperbilirrubinemia conjugada / Familial cholestasis: a comon cause of conjugated hyperbilurubinemia

Cholestasis is defined as a disorder affecting the production of bile resulting in the retention of its components in the liver and blood. In children, this disorder is almost always due to genetic alterations. Functionally, cholestasis may be the result of hepatic failure to secrete bile due to decrease in transport, synthesis or biliary obstruction. Extrahepatic cholestasis may be caused by biliary atresia and other obstructions of the bile ducts. Intrahepatic cholestasis may be the result of several disorders including progressive familial intrahepatic cholestasis (PFIC) types 1, 2 and 3, an autosomal recessive disease due to mutations in the genes ATP8B1, ABCBll and ABCB4 respectively. Pathophysiology and clinical presentation of this disease are now well understood. Clinically, these patients may present with jaundice, itching, anorexia, and generally unwell. Laboratory tests may disclose conjugated bilirubin over lmg/dl or larger than 20 percent of total bilirubin. Ursodeoxycholic acid, cholestiramine and biliary diversion may help in some of these conditions. Ongoing research into the mechanisms of genetic cholestasis could be key to therapy.

La Colestasia corresponde a un trastorno en la formación y excreción de la bilis que provoca retención de sus componentes y daño en hígado y sangre. La colestasia en el niño casi siempre se debe a una alteración hepática secundaria a causas ahora mayormente conocidas a nivel molecular. Desde el punto de vista funcional la colestasia resulta de una insuficiencia secretora del hígado debido a una disminución del flujo biliar por falla en los procesos de transporte o síntesis o a una obstrucción de la vía biliar. La colestasia extrahepática incluye la atresia de vías biliares y otras obstrucciones de la vía biliar. La colestasia intrahepática incluye las colestasias progresivas familiares PFIC 1, 2 y 3 causadas por fallas en los genes ATP8B1, ABCBll y ABCB4 respectivamente. Clínicamente pueden presentarse con ictericia, prurito, anorexia y compromiso del estado general. Desde el punto de vista del laboratorio las enfermedades colestásicas se caracterizan por hiperbilirrubinemia conjugada mayor a 1 mg/dl o mayor a 20 por ciento de bilirrubina total.