Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 38
Filtrar
1.
Chinese Pharmacological Bulletin ; (12): 1648-1654, 2023.
Artículo en Chino | WPRIM | ID: wpr-1013718

RESUMEN

Aim To investigate the effects of cimifugin on mouse atopic dermatitis (AD) induced by fluorescein isothiocyanate (FITC) and further explore the mechanism of its action. Methods ICR mice were randomly divided into blank group, model group, positive group (dexamethasone),low dose group,high dose group and administration group of cimifugin. FITC solution was applied to the shaved abdomen of mice in the sensitization stage, and 0.6 % FITC solution was applied to attack the ears of mice in the stimulation stage. The administration groups were given medicine for seven consecutive days. The effects of cimifugin on body weight, thymus index and spleen index of mice were detected. Ear inflammatory cell infiltration was observed by HE staining. The ear swelling of mice was measured, and Th2 cytokines IL-5,IL-13 and the key promoter of allergy IL-33 were detected by ELISA. The epithelial barrier structural proteins, filaggrin, claudinl,occludin and E-cadherin,were detected by immunohistochemistry and Western blot. Results Compared with the blank group, the model group showed significant AD symptoms. Compared with the model group, cimifugin transdermal administration group significantly reduced ear inflammatory cell infiltration,ear swelling, IL-5,IL-13 and IL-33, and significantly increased the expression of filaggrin and occludin. Conclusions Transdermal administration of cimifugin could significantly inhibit AD in mice, and its mechanism involves repairing epithelial barrier function, restoring filaggrin and occludin, inhibiting allergy promoting factor IL-33, and finally inhibiting AD inflammation.

2.
Rev. argent. dermatol ; 100(4): 101-110, dic. 2019. graf
Artículo en Español | LILACS-Express | LILACS | ID: biblio-1092400

RESUMEN

RESUMEN La Pitiriasis alba es una enfermedad cutánea inespecífica de etiología desconocida, caracterizada por máculas hipocrómicas, redondeadas u ovaladas poco delimitadas y cubiertas con escamas finas que ocurren usualmente en la región facial de los niños. Fue descrita por Gilbert en 1860 y Fox en 1923, pero fue O'Farrell en 1956 quien propuso el nombre de Pitiriasis alba. La condición dermatológica con la que suele asociarse es la dermatitis atópica. La presencia de Pitiriasis alba fue definida como uno de los criterios menores para el diagnóstico de Dermatitis atópica, según Hanifin y Rajka en 1980. Sin embargo, también se presenta en 20-40% de los niños atópicos, sin evidencia de Dermatitis atópica, así como en individuos no atópicos. La disfunción de la barrera epitelial causada por mutaciones del gen de la filagrina, proteína estructural epidérmica, que forma parte del factor humectante natural, se considera un factor de riesgo emergente para la Dermatitis atópica severa de comienzo precoz. Se presenta un caso de Pitiriasis albaen el que fue necesaria terapia combinada tópica y vía oral, con evolución satisfactoria en 8 semanas de tratamiento.


SUMMARY Pityriasis Alba is a non-specific skin disease of unknown etiology characterized by hypochromic macules, rounded or oval, poorly defined and covered with fine scales that usually occur in the facial region of children. It was described by Gilbert in 1860 and Fox in 1923, but it was O'Farrell in 1956 who proposed the name Pityriasis alba. The dermatological condition with which it is usually associated is Atopic dermatitis. The presence of Pityriasis alba was defined as one of the minor criteria for the diagnosis of Atopic dermatitis, according to Hanifin and Rajka in 1980. However, it also occurs in 20-40% of atopic children, without evidence of Atopic dermatitis, as well as in non-atopic individuals. Epithelial barrier dysfunction caused by mutations of the filaggrin gene, epidermal structural protein, which is part of the natural humectant factor, is considered an emerging risk factor for severe early onset Atopic dermatitis. We present a case of Pityriasis alba where combined topical and systemic therapy was necessary with satisfactory evolution in 8 weeks of treatment.

3.
Korean Journal of Dermatology ; : 363-370, 2019.
Artículo en Coreano | WPRIM | ID: wpr-759770

RESUMEN

BACKGROUND: Mutation in the gene encoding filaggrin (FLG) is a major predisposing factor for atopic dermatitis (AD), in association with distinct features such as increased allergic sensitization, higher severity, and frequent skin infections. Genetic diversity in FLG mutations exists across ethnicities. OBJECTIVE: This study aimed to investigate the clinical features of AD according to the presence of FLG mutation in Korean individuals. METHODS: We performed reverse blot hybridization assay to detect FLG mutation in Korean patients with AD. Classifying subjects into AD with or without FLG mutation, clinical features of AD and patch test results were compared between the two groups. RESULTS: Among a total of 281 subjects, 39 (13.9%) were found to have FLG mutation. AD with FLG mutation was associated with higher risk of impetigo and eczema herpeticum but lower risk of prurigo nodularis. In the patch test, there was no difference in positive reactions of major contact allergens between the groups. CONCLUSION: In Korean patients with AD, FLG mutation was associated with more frequent skin infections but not with personal or family history of atopic diseases, allergic sensitization, contact allergy, and protracted course. It is important to consider other skin-barrier-related genes, such as KLK7 and SPINK5, and immune response-related genes in conjunction.


Asunto(s)
Humanos , Alérgenos , Causalidad , Dermatitis Atópica , Variación Genética , Hipersensibilidad , Impétigo , Erupción Variceliforme de Kaposi , Pruebas del Parche , Prurigo , Piel
4.
Journal of Prevention and Treatment for Stomatological Diseases ; (12): 557-560, 2019.
Artículo en Chino | WPRIM | ID: wpr-750424

RESUMEN

Objective@#To study the expression and distribution of filaggrin (FLG) in oral submucous fibrosis (OSF) and to explore the significance of FLG in the occurrence and development of OSF.@*Methods @#Ten cases with a normal oral mucosa (normal buccal mucosa group) and 30 cases of tissues with OSF lesions, including 10 cases each in the early (early OSF group), moderate (middle OSF group) and advanced stages (late OSF group), were selected. FLG was analyzed by immunohistochemistry. The FLG-positive cells were counted to calculate the percentages of cells with FLG-positive expression in each group.@*Results@#FLG expression was negative in most of the normal buccal mucosa group specimens and was positive in the OSF buccal mucosal epithelial specimens. With aggravation of the OSF lesion, the number of FLG-positive cells increased. In the early OSF group, FLG-positive expression was mainly concentrated in the granular and keratinized epithelial layers. In the middle OSF group, the number of FLG-positive epithelial cells increased gradually. In the late OSF group, almost all epithelial cells were FLG-positive in the cytoplasmic nucleus. The percentages of FLG-positive cells in the early, middle and late OSF groups were (24.63 ± 9.06)%, (54.23 ± 10.63)% and (83.97 ± 8.72)%, respectively. The percentage of FLG-positive cells was significantly higher in the OSF group than in the normal mucosa group (P < 0.05).@*Conclusion@#FLG was expressed at a higher level in the OSF epithelium than in the normal oral mucosal epithelium and was upregulated in the OSF epithelium with aggravation of the OSF lesions. Abnormal FLG expression may be related to the terminal differentiation disorder of OSF epithelial keratinocytes.

5.
Annals of Dermatology ; : 645-652, 2018.
Artículo en Inglés | WPRIM | ID: wpr-719028

RESUMEN

BACKGROUND: Adiponectin, an adipokine secreted from adipocytes, affects energy metabolism and also shows anti-diabetic and anti-inflammatory properties. Recent studies have reported that adiponectin plays a role in regulating skin inflammation. OBJECTIVE: This study aimed to investigate the effect of adiponectin on the expression of filaggrin (FLG) in normal human epidermal keratinocytes (NHEKs). METHODS: NHEKs were serum-starved for 6h before being treated with adiponectin. Afterward, cell viability was assessed by MTT assay. We also treated with calcium, interleukin (IL)-4, and IL-13 to provide positive and negative comparative controls, respectively. Gene mRNA expression was quantified using real time reverse transcription polymerase chain reaction, and protein expression was evaluated using Western blot. To evaluate the relationship among mitogen-activated protein kinases (MAPKs), activator protein 1 (AP-1), and FLG, we also treated cells with inhibitors for MAPKs JNK, p38, and ERK1/2. RESULTS: FLG and FLG-2 mRNA expression in NHEKs significantly increased after treatment with 10 µg/ml adiponectin. Adiponectin also restored FLG and FLG-2 mRNA expression that was otherwise inhibited by treatment with IL-4 and IL-13. Adiponectin induced FLG expression via AP-1 and MAPK signaling. CONCLUSION: Adiponectin positively regulated the expression of FLG and could be useful as a therapeutic agent to control diseases related to disrupted skin barrier function.


Asunto(s)
Humanos , Adipocitos , Adipoquinas , Adiponectina , Western Blotting , Calcio , Diferenciación Celular , Supervivencia Celular , Metabolismo Energético , Inflamación , Interleucina-13 , Interleucina-4 , Interleucinas , Queratinocitos , Proteínas Quinasas Activadas por Mitógenos , Reacción en Cadena de la Polimerasa , Transcripción Reversa , ARN Mensajero , Piel , Factor de Transcripción AP-1
6.
Chinese Journal of Dermatology ; (12): 806-809, 2017.
Artículo en Chino | WPRIM | ID: wpr-667713

RESUMEN

Objective To investigate the association of polymorphisms in the filaggrin (FLG)gene with the occurrence and clinical phenotypes of atopic dermatitis (AD).Methods A questionnaire survey was carried out to collect data from 261 patients with AD,including the diagnosis of allergic rhinitis and asthma,and the severity of AD.Mixed food allergen screening test and mixed inhaled allergen screening test were performed in a part of patients,so was the detection of total serum IgE and eosinophil cationic protein (ECP).Among the above AD patients and 276 healthy controls,17 polymorphic sites in exon 3 of the FLG gene,including R444G,T454A,P478S,H519N,D836D,S1482Y,A1805V,R1891Q,1961Q,S2166S,Y2194H,H2330H,D2339N,S2366T,E2398Q,K2444E and E2652D,were genotyped by overlapping PCR and DNA sequencing.Results Binary logistic regression analysis and chi-square test showed no correlations between the 17 polymorphic sites in the FLG gene and the occurrence of AD (all P > 0.05).However,the H519N polymorphic site was associated with AD complicated by asthma (x2 =8.680,P =0.011),and the AA genotype of H519N could increase the risk of asthma in the AD patients (P =0.004,OR =1.061,95% CI:1.016-1.109).The S2366T and K2444E polymorphic sites were associated with food sensitization in the AD patients (x2 =6.520,6.121,P =0.038,0.047,respectively),and the GG + CG genotype of S2366T (P =0.012,OR =1.396,95% CI:1.054-1.849)and its G allele (P =0.037,OR =1.350,95% CI:1.008-1.807) both could increase the risk of food sensitization in the AD patients.Similarly,the AA + GA genotype of K2444E (P =0.013,OR =1.393,95% CI:1.049-1.850)and its G allele (P =0.028,OR =1.380,95% CI:1.025-1.857) could increase the risk of food sensitization in the AD patients.Conclusions The FLG polymorphisms may be predisposing factors for some AD-related clinical phenotypes in Chinese Han population.The H519N gene may be associated with AD complicated by asthma,and the S2366T and K2444E genes may be related to food sensitization in AD patients.

7.
Yonsei Medical Journal ; : 395-400, 2017.
Artículo en Inglés | WPRIM | ID: wpr-174321

RESUMEN

PURPOSE: Atopic dermatitis (AD) is a chronic, relapsing eczematous inflammatory skin disease. Mutations in the filaggrin gene (FLG) are major predisposing factors for AD. Ethnic differences exist between Asian and European populations in the frequency and spectrum of FLG mutations. Moreover, a distinct set of FLG mutations has been reported in Asian populations. The aim of this study was to examine the spectrum of FLG mutations in Koreans with AD. We also investigated the association of FLG mutations and clinical features of AD and compared the Korean FLG landscape with that of other East Asian countries. MATERIALS AND METHODS: Seventy Korean patients with AD were enrolled in this study. Fourteen FLG mutations previously detected in Korean, Japanese, and Chinese patients were screened by genotyping. RESULTS: Four FLG null mutations (3321delA, K4022X, S3296X, and S2889X) were identified in eleven patients (15.7%). The most commonly detected mutations in Korean patients with AD were 3321delA (n=6, 9.1%) and K4022X (n=3, 4.5%). FLG mutations were significantly associated with elevated IgE (≥200 KIU/L and/or MAST-CLA >3+, p=0.005), palmar hyperlinearity (p<0.001), and a family history of allergic disease (p=0.021). CONCLUSION: This study expanded our understanding of the landscape of FLG mutations in Koreans and revealed an association between FLG mutations and AD phenotype.


Asunto(s)
Humanos , Pueblo Asiatico , Causalidad , Dermatitis Atópica , Inmunoglobulina E , Fenotipo , Enfermedades de la Piel
8.
Annals of Dermatology ; : 407-413, 2017.
Artículo en Inglés | WPRIM | ID: wpr-86521

RESUMEN

BACKGROUND: Filaggrin (FLG) is the major component of the epidermal granular layer and binds to and condenses the keratin cytoskeleton. FLG thus contributes to cell compaction and serves as a natural moisturizing factor by promoting unfolding and degradation into hygroscopic amino acids. Loss or downregulation of FLG has been shown to result in a weak stratum corneum, which causes water loss and increases the possibility of skin barrier-related seizure. Adiponectin (Acrp30) contributes to the functional recovery of somatic cells, including human normal epidermal keratinocytes (NHEKs). OBJECTIVE: To investigate the effect of Acrp30 in FLG expression and identifying its signal transduction mechanism. METHODS: Normal human keratinocytes were treated with Acrp30 and the levels of FLG were examined. Silent mating type information regulation 2 homolog (SIRT)-targeting siRNA and aryl hydrocarbon receptor nuclear translocator (ARNT)-targeting siRNA were used to identify the role of various signal transduction pathway components. RESULTS: Acrp30 upregulated SIRT1 and ARNT expression in NHEKs, resulting in increased FLG expression. Treatment with both SIRT1-targeting siRNA and ARNT-targeting siRNA blocked Acrp30 stimulation and silenced FLG expression. CONCLUSION: Adiponectin upregulates FLG expression through a SIRT1-mediated pathway. Our results suggest that Acrp30 is a promising agent for skin barrier permeability improvement.


Asunto(s)
Humanos , Adiponectina , Aminoácidos , Translocador Nuclear del Receptor de Aril Hidrocarburo , Citoesqueleto , Regulación hacia Abajo , Queratinocitos , Permeabilidad , ARN Interferente Pequeño , Convulsiones , Transducción de Señal , Piel , Agua
9.
Journal of Korean Medical Science ; : 1136-1142, 2016.
Artículo en Inglés | WPRIM | ID: wpr-13346

RESUMEN

Research of the FLG mutation in various ethnic groups revealed non-overlapping mutation patterns. In addition, Japanese and Chinese atopic patients showed somewhat different mutations. These ethnic differences make the research on Korean patients mandatory; however, no systematic research on Korean atopic dermatitis (AD) patients has been performed. This study aims to investigate the genetic polymorphism of FLG in Korean atopic dermatitis patients. The study was made up of three groups including 9 Ichthyosis vulgaris (IV) patients, 50 AD patients and 55 normal controls: the ichthyosis group was incorporated due to the reported association between the FLG mutation and IV. In comparison to other sequencing methods, the overlapping long-range PCR was used. We revealed the genetic polymorphism of filaggrin in Koreans, and at the same time, we discovered nonsense mutations in p.Y1767X and p.K4022X in Korean AD patients. By using FLG sequencing techniques confirmed in this study, new mutations or genetic polymorphisms with ethnic characteristics would be detected and further larger studies of repeat number polymorphisms could be performed.


Asunto(s)
Adulto , Femenino , Humanos , Masculino , Alelos , Pueblo Asiatico/genética , Secuencia de Bases , Codón sin Sentido , ADN/sangre , Análisis Mutacional de ADN , Dermatitis Atópica/genética , Genotipo , Heterocigoto , Ictiosis Vulgar/genética , Proteínas de Filamentos Intermediarios/genética , Reacción en Cadena de la Polimerasa , Polimorfismo de Nucleótido Simple
10.
Journal of Nutrition and Health ; : 269-276, 2016.
Artículo en Coreano | WPRIM | ID: wpr-195328

RESUMEN

PURPOSE: Ultraviolet (UV) irradiation decreases epidermal hydration, which is maintained by reduction of natural moisturizing factors (NMFs). Among various NMFs, free amino acids (AA) are major constituents generated by filaggrin degradation. This experiment was conducted to determine whether or not dietary supplementation of green tea extract (GTE) in UV-irradiated mice can improve epidermal levels of hydration, filaggrin, free AAs, and peptidylarginine deiminase-3 (PAD3) expression (an enzyme involved in filaggrin degradation). METHODS: Hairless mice were fed a diet of 1% GTE for 10 weeks in parallel with UV irradiation (group UV+1%GTE). As controls, hairless mice were fed a control diet in parallel with (group UV+) or without (group UV-) UV irradiation. RESULTS: In group UV+, epidermal levels of hydration and filaggrin were lower than those in group UV-; these levels increased in group UV+1% GTE to levels similar to group UV-. Epidermal levels of PAD3 and major AAs of NMF, alanine, glycine and serine were similar in groups UV- and UV+, whereas these levels highly increased in group UV+1% GTE. CONCLUSION: Dietary GTE improves epidermal hydration by filaggrin generation and degradation into AAs.


Asunto(s)
Animales , Ratones , Alanina , Aminoácidos , Dieta , Suplementos Dietéticos , Epidermis , Glicina , Metabolismo , Ratones Pelados , Serina ,
11.
Braz. j. med. biol. res ; 48(1): 39-45, 01/2015. graf
Artículo en Inglés | LILACS | ID: lil-730436

RESUMEN

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

12.
Chinese Journal of Dermatology ; (12): 629-632, 2015.
Artículo en Chino | WPRIM | ID: wpr-476223

RESUMEN

Objective To investigate the prevalence and progression process of atopic diseases in adolescents, and to assess their relationship with filaggrin(FLG)mutations. Methods Totally, 334 adolescents aged from 11 to 19 years in a middle school in shanghai were enrolled into this study. A clinical interview was carried out to determine the prevalence of atopic diseases (such as ichthyosis, atopic dermatitis (AD), asthma, rhinitis, etc)in these subjects. Peripheral blood samples were collected from 285 out of the 334 adolescents for screening for common FLG mutations, including 3321delA and K4671X. Five years later, these adolescents were followed up for reevaluation of clinical presentations of atopic diseases. Statistical analysis was carried out by the chi-square test with the SPSS 20.0 software. Results As the baseline survey showed, 19 (5.69%)of the 334 adolescents had AD, 14 (4.19%)had ichthyosis vulgaris, 36(10.78%)had allergic rhinitis, and 4(1.20%)had asthma. FLG mutations were observed in 24(8.42%) of the 285 adolescents. Five years later, 265 adoscents completed the follow-up, and 69 (20.66%)were lost to follow-up. Of the 265 adolescents reevaluated, 13(4.89%)had AD, 15(5.64%)had ichthyosis vulgaris, 27(10.15%)had allergic rhinitis, and 1 (0.38%)had asthma. By the time the second survey was performed, 6 out of the 19 patients initially diagnosed with AD had achieved complete regression, 13 had experienced a marked decrease in SCORing atopic dermatitis (SCORAD)score, and symptoms had disappeared in 9 of the 36 patients initially diagnosed with allergic rhinitis. The frequency of FLG mutations was 10.0%in patients with AD, 55.6%in those with ichthyosis, and 40.0%in those with both AD and ichthyosis, and the development of ichthyosis was associated with FLG mutations(P<0.001). Conclusions The frequency of common FLG mutations was 8.42%in these adolescents. FLG gene may be a semidominant gene associated with ichthyosis vulgaris, and multiple factors influence its expression.

13.
Artículo en Inglés | IMSEAR | ID: sea-151977

RESUMEN

Montelukast is one of leukotriene (LT) receptor antagonists, which is safe and effective drug as a combined systemic and topical treatment regimen for treatment of moderate-to-severe atopic dermatitis (AD). The present study aimed to evaluate the role of montelukast treatment in modulation of filaggrin R501X and 2282derl4 mutations in Egyptian patients with atopic dermatitis. Total of (32) patients with AD and 16 healthy non-AD volunteers with no allergic disease were enrolled in this study. Patients were given montelukast sodium 4 mg daily for 2 weeks. SCORAD, total IgE levels and eosinophils counts were measured. Genotyping for FLG gene mutations R501X and 2282del4 were evaluated. Montelukast treatment showed significant improvement in AD patients through the reduction of serum IgE levels, blood eosinophils counts and disease severity. FLG 2282del4 mutation could be detected in 76.9% of the AD patients. FLG 2282del4 mutation was modulated in 4 out of 20 AD patients upon treatment with montelukast. Montelukast treatment could improve the skin barrier integrity through its modulatory effect on FLG mutation 2282del4 in the Egyptian patients.

14.
Chinese Journal of Dermatology ; (12): 251-254, 2014.
Artículo en Chino | WPRIM | ID: wpr-447015

RESUMEN

Objective To detect mutations in the filaggrin (FLG) gene and expressions of FLG and loricrin in patients with ichthyosis vulgaris (Ⅳ),and to investigate their clinical significance.Methods Tissue specimens were resected from the skin lesions of 10 patients with Ⅳ and normal skin of 14 healthy human controls,and immunohistochemical SP method was used to detect the expressions of filaggrin and loricrin.The expression intensity was determined by the Image-Pro Plus (IPP) software,and expressed as positive units (PU).Blood samples were collected from 10 patients of Han nationality with Ⅳ and 100 healthy human controls followed by DNA extraction.PCR and DNA sequencing were performed to detect the presence of 13 mutations (3321delA,441delA,1249insG,E1795X,S3296X,R501X,2282de14,R2447X,S2889X,7945delA,3702delG,Q2417X,R4307X) in the FLG gene.Results FLG was mainly expressed in the cytoplasm of keratinocytes in the stratum corneum,granular layer,prickle layer and basal layer,and loricrin was observed in the cytoplasm and nuclei of keratinocytes in the granular layer,prickle layer and basal layer,in both the lesional and normal skin.Compared with the normal skin,the lesional skin showed significantly weaker expressions of FLG (0.208 2 ± 0.008 0 vs.0.230 0 ± 0.0228,t =3.30,P < 0.01) and loricrin (0.137 0 ± 0.011 2 vs.0.149 3 ± 0.007 3,t =3.07,P < 0.01).Sequencing analysis identified two mutations,including 3321delA in 7 patients and 441delA in 2 patients.No mutations were detected in the healthy controls.Conclusions The 3321delA and 441delA mutations in the FLG gene may represent the most frequent genetic cause of Ⅳ in patients of Han nationality.The low expressions of FLG and loricrin may be associated with the impairment of skin barrier function in patients with Ⅳ.

15.
Journal of the Korean Medical Association ; : 218-225, 2014.
Artículo en Coreano | WPRIM | ID: wpr-111990

RESUMEN

Atopic dermatitis (AD) is a chronic relapsing inflammatory skin disease with severe pruritus, and the first step of atopic march since it often precedes asthma or allergic rhinitis. Since its etiology or pathogenesis is very complex and frequently changing, physicians cannot easily understand it in entirety. New insights into the genetics and pathophysiology of AD emphasize the crucial function of the skin barrier as well as abnormal immune response. In this review, the pathogenesis of AD is explained as the combined features of impaired skin barrier and abnormal immune response rather than each independent concept. Understanding the whole pathogenesis of AD may lead to early intervention and prevention of atopic march as well as proper clinical treatment.


Asunto(s)
Asma , Dermatitis Atópica , Intervención Educativa Precoz , Genética , Hipersensibilidad , Prurito , Rinitis , Piel , Enfermedades de la Piel
16.
Artículo en Inglés | IMSEAR | ID: sea-155100

RESUMEN

Background & objectives: Atopic diseases, including atopic dermatitis (AD), allergy and asthma, are complex diseases resulting from the effect of multiple genetic and interacting environmental factors on their pathophysiology. The genetic basis is incompletely understood; however, recent studies have shown an association between loss-of-function variants of the filaggrin gene (FLG) and atopic dermatitis. The aim of this study was to determine whether FLG variants can serve as a predictor for atopic diseases in Korean individuals. Methods: A total of 648 subjects were genotyped for the FLG P478S (rs11584340, C/T base change) polymorphism (322 patients and 326 controls). Serum levels of free fatty acids (FFA) and IgE were later stratified to determine the effects of the FLG polymorphism on AD. Results: A significant difference in genotype frequency was found between AD patients and controls in the FLG P478S polymorphism. The FLG P478S T allele carrier (TT+TC) was associated with AD risk (odds ratio = 1.877, 95% confidence interval 1.089 to 3.234). In addition, the P478S T allele was related to high levels of FFA in AD patients (471.79 ± 298.96 vs. 333.54 ± 175.82 μg eq/l, P <0.05). Interpretation & conclusions: The results of the present study suggest that the FLG P478S polymorphism alone and combined with other factors influences FFA levels and increases the susceptibility to AD.

17.
Asia Pacific Allergy ; (4): 79-87, 2013.
Artículo en Inglés | WPRIM | ID: wpr-749946

RESUMEN

Atopic dermatitis (AD) is a very common chronic disease that reportedly affects 10%-20% of the general population. The prevalence of AD appears to be steadily increasing, at least in developing countries. Two pathogenetic mechanisms have been mentioned. Traditionally immunological aberrations are thought to be a primary event in the initial development of AD ("inside-to-outside hypothesis"). Another hypothesis assumes that there is an intrinsic defect in epidermal barrier. Due to this barrier defect, allergens or irritants can easily penetrate the epidermal barrier, and induce immunologic reaction secondarily ("outside-to-inside hypothesis"). These days the epidermal barrier defect seems to gain more support as a primary event than immunological aberrations in the early changes of AD since the filaggrin mutation was reported in AD patients. Clinically AD initially affects face, and with age, flexural areas are typically involved. AD has many different clinical features. Diagnostic criteria for AD in each country may be a little different, although based on the criteria proposed by Hanifin and Rajka. AD can be controlled effectively with topical and/or systemic treatments and fortunately spontaneously disappears with age. However, in some cases very resistant to conventional therapies, additional treatments such as immunosuppressive agents are needed.


Asunto(s)
Humanos , Alérgenos , Enfermedad Crónica , Dermatitis Atópica , Países en Desarrollo , Inmunosupresores , Irritantes , Prevalencia
18.
Allergy, Asthma & Respiratory Disease ; : 20-28, 2013.
Artículo en Coreano | WPRIM | ID: wpr-122736

RESUMEN

Atopic dermatitis is a chronic relapsing eczematous dermatosis, which usually starts in childhood, and various causes are intricately associated with the development of the disease. Recently, various abnormalities in barrier function have been identified as the cause of atopic dermatitis. Loss-of-function mutation of filaggrin, a significant constituent of skin barrier, has been revealed as a cause for atopic dermatitis, and factors like enhanced protease activity, and decreased synthesis of the lipid lamellae especially ceramides also plays an important role in barrier dysfunction. Not only these genetic causes but also environmental factors are associated in barrier dysfunction, such as soap or detergents which increases skin pH, or proteases of dust mites or cockroaches which enhances epidermal barrier breakdown. Lately, skin barrier dysfunction is also thought to play an important role in the early stage of other allergic diseases such as asthma. Therefore, comprehension of the function of skin barrier can provide help in understanding various allergic diseases.


Asunto(s)
Asma , Ceramidas , Cucarachas , Comprensión , Dermatitis Atópica , Detergentes , Polvo , Concentración de Iones de Hidrógeno , Proteínas de Filamentos Intermediarios , Ácaros , Péptido Hidrolasas , Piel , Enfermedades de la Piel , Jabones
19.
The Korean Journal of Nutrition ; : 109-118, 2013.
Artículo en Coreano | WPRIM | ID: wpr-655291

RESUMEN

Ultraviolet (UV) irradiation reduces epidermal hydration, which is paralleled by the reduction of natural moisturizing factors (NMFs). Of various NMFs, free amino acids (AAs) are major constituents generated by filaggrin degradation. In this study, we attempted to determine whether dietary supplementation of royal jelly (RJ) in UV-irradiated mice can alters epidermal levels of hydration, filaggrins, and free AAs as well as of peptidylarginine deiminase-3 (PAD3), an enzyme involved in filaggrin degradation processes. Albino hairless mice were fed either a control diet (group UV+: UV irradiated control) or diets with 1% RJ harvested from different areas in Korea (groups RJ1, RJ2, and RJ3) or imported from China (group RJ4) for six weeks in parallel with UV irradiation. A normal control group (group UV-) was fed a control diet without UV irradiation for six weeks. Reduced epidermal levels of hydration, total filaggrins, and PAD3 were observed in group UV+; in group RJ1, these levels were increased to a level similar to that of group UV-. In addition, profilaggrins, two repeat intermediates (2RI), a precursor with two filaggrin repeats, and filaggrin were increased. Although no alteration of AAs was observed in any of the groups, and glutamate and serine, major AAs of NMF in group RJ1 were higher than in group UV+. Despite the increased levels of PAD3, epidermal levels of hydration, filaggrins, glutamate, and serine in groups RJ2, RJ3, and RJ4 were similar to those in group UV+. Dietary supplementation of RJ1 improves epidermal hydration in parallel with enhanced expression and degradation of filaggrin, but not by increased protein expression of PAD3, along with increased generation of glutamate and serine.


Asunto(s)
Animales , Ratones , Aminoácidos , China , Dieta , Suplementos Dietéticos , Ácidos Grasos , Ácido Glutámico , Proteínas de Filamentos Intermediarios , Corea (Geográfico) , Ratones Pelados , Serina
20.
Allergy, Asthma & Immunology Research ; : 211-215, 2013.
Artículo en Inglés | WPRIM | ID: wpr-172369

RESUMEN

PURPOSE: Filaggrin (FLG) is a key protein that facilitates the terminal differentiation of the epidermis and the formation of the skin barrier. Recent studies showed that atopic dermatitis (AD) associates closely with loss-of-function mutations in the FLG gene. Asian and European populations differ in the frequencies of FLG mutations. Several FLG mutations, including 3321delA, E2422X, K4671X, S2554X, and R501X, occur frequently in Chinese and Japanese populations. The association between three FLG null mutations and AD in Korean children was investigated. METHODS: The FLG mutations in 1,430 children (aged 0-18 years) with AD and 862 control subjects were genotyped by using the TaqMan assay. RESULTS: The FLG null mutation E2422X was not detected in any patients with AD or control subjects. The R501X null mutation was detected in only one child with AD (0.1%). Children with AD had the 3321delA deletion significantly more frequently (2.4%) than the control subjects (0.0%, P<0.001). Children with AD also had a significantly higher combined allele frequency of the three FLG null mutations (2.6%) than the controls (0.0%, P<0.001). The 3321delA null mutation did not associate significantly with AD severity (P=0.842). When the patients with AD were divided into allergic AD and non-allergic AD patient groups, these two groups did not differ in terms of the frequency of 3321delA. CONCLUSIONS: The Korean children had a lower frequency of FLG mutations than European populations. FLG null mutations may be associated with the development of AD in Korean children.


Asunto(s)
Niño , Humanos , Pueblo Asiatico , Dermatitis Atópica , Epidermis , Frecuencia de los Genes , Proteínas de Filamentos Intermediarios , Piel
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA