Résumé
Acute ischemic stroke is a cerebrovascular disease with high incidence, high mortality and disability, and high recurrence rate, which seriously endangers patients’ health. Thrombolytic drugs play a key role in the treatment of acute ischemic stroke by activating plasminogen, rapidly dissolving thrombi, reducing platelet aggregation, and achieving successful recanalization. In this study, we reviewed the principle of action of thrombolytic drugs, their classification and use on the basis of current research progress at home and abroad. The results show that the safety and efficacy of thrombolytic drugs have improved significantly from the first generation of thrombolytic drugs, streptokinase, which is not fibrin-specific, to the third generation of thrombolytic drugs, tenecteplase, which not only retain the characteristics of directly activating plasminogen, but also enhance the specificity of fibrin and prolong the half-life. With the development of research, small-molecular compounds with the inhibition of plasminogen activator, or the modification of thrombolytic drugs with strong anti-plasminogen activator inhibition activity in vivo, or the search for new small-molecular substances with thrombolytic effect from microorganisms and natural plants, have become the focus of research on new thrombolytic drugs. The new thrombolytic drugs are likely to replace the current thrombolytic drugs because of greater thrombolytic efficacy and fewer side effects.
Résumé
In the field of medical education, Ethiopia has made a great progress in recent years. After systematical inquiry of Ethiopia's clinical medical education, this paper elaborates the mode of undergraduate teaching in Ethiopia from aspects of curriculum design, emphasis of contents, teaching methods and assessment methods, and also introduces the development and continuing education of Ethiopian medical students after graduation. Moreover, the "Innovative Track" clinical medical education reform proposed by Ethiopia recently is introduced as well. Therefore, characteristics and advantages of clinical teaching in Ethiopia indicate that in the process of deepening the medical education reform in China, we should learn from different countries. In this way, the development of medical education in China can be promoted better and faster.
Résumé
<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>
Sujets)
Adulte , Sujet âgé , Femelle , Humains , Mâle , Adulte d'âge moyen , Gènes nf2 , Mutation , Neurinome , Génétique , Tumeurs de la moelle épinière , GénétiqueRésumé
Objective To observe the dynamic changes of serum inflammatory factors after vertebral artery stenting and to investigate its clinical significance. Methods A total of 48 patients treated with vertebral artery stenting were included, and 48 patients only received cerebral angiography were used as a control group. The levels of soluble intercellular adhesion molecule-1 (sICAM-1), high-sensitivity C-reactive protein (hs-CRP) and tumor-necrosis factor-α (TNF-α) were detected before procedure (angiography), at 24 h, 48 h, 3 d, and 1 and 3 weeks after procedure (angiography). Results The serum levels of hs-CRP (4. 85 ± 0. 53 mg/L vs. 2. 57 ±0. 36 mg/L,P<0. 05), TNF-α (2.42 ±0. 34 μg/L vs. 1. 08 ±0. 37 μg/L,P <0. 05) and sICAM-1 (449.43 ± 47. 16 μg/L vs. 269. 15 ± 37. 46 μg/L, P < 0. 05) at 24 hours after procedure in the stenting group were significantly elevated compared with those before procedure. The Hs-CRP level (6.24 ± 0.59 mg/L) reached the peak at 48 hours after procedure. At week 3 (2. 51 ±0.29 mg/L), it returned to the level before procedure (2. 57 ±0. 36 mg/L); TNF-α level reached the peak at day 3 (2.30 ± 0.25 μg/L), and it remained higher level at week 3 (1. 89 ±0. 13 μg/L); the sICAM-1 level continued to rise at week 3 (296. 95 ± 59. 72 μg/L). The serum hs-CRP, TNF-α and sICAM-1 levels at 24 hours after procedure in the stenting group were significantly higher than those (3. 25 ±0.40 mg/L、J. 18 ±0. 19 μg/L and 336. 57 ± 50. 18μg/L) in the control group (all P<0.05). Conclusions The serum hs-CRP, TNF-α, sICAM-1 levels were significantly elevated after vertebral artery stenting. It was suggested that the stenting caused a longer duration of inflammatory response.
Résumé
Objective To investigate the efficacy of intra-arterial thrombolysis with stenting for acute cerebral infarction. Methods Using a prospective case-control design, 24 patients with acute cerebral infarction who remained angiostegnosis ( > 50%) after intra-arterial thrombolysis were randomly divided into stent treatment group and drug treatment group. They were treated with stenting + drug treatment and conventional drug treatment. The rates of vascular complete revascularization and residual stenosis, and the modified Rankin scale scores at 3 months in both groups were evaluated. Results The rate of complete revascularization in the stent treatment group was significantly higher than that in the drug treatment group (54. 5% vs.0%,χ2 =6.382, P <0. 001), and the rate of residual stenosis was significantly lower than that in the drug treatment group ([4.5 ±5.2]% vs. [82. 5 ±10. 5]%, t =7.464, P<0.001). The rate of favorable clinical outcome in the stent treatment group was significantly higher than that in the drug treatment group (100% vs. 76. 9%,χ2 = 14. 263, P = 0.038). Conclusion The efficacy of intra-arterial thrombolysis with stenting in the treatment of acute cerebral infarction is superior to that in the drug treatment group, and it is safer.
Résumé
To study the current situation and affecting factors of bilingual teaching for Neurology,we investigated the students of a five-year medical undergraduade in clinical medicine with a questionaire.It will provide the data and reference to effectively improve bilingual teaching program for Neurology.
Résumé
<p><b>OBJECTIVE</b>To investigate the expression of Toll-like receptor 2 (TLR2) and Toll-like receptor 4 (TLR4) and the effect of lipopolysaccharide (LPS) on their expression in cultured endothelial cells.</p><p><b>METHODS</b>Total RNA was extracted from ECV304 cells and isolated human umbilical vein endothelial cells (HUVECs) exposed to LPS, respectively. The quantification of TLR2 and TLR4 mRNA in HUVECs and EVC304 cells was carried out by reverse transcriptase-polymerase chain reaction (RT-PCR).</p><p><b>RESULTS</b>ECV304 cells and HUVECs were able to express TLR2 and TLR4 mRNA, but the expression levels of TLR4 appeared to be stronger than those of TLR2. LPS could upregulate the expression levels of TLR4 obviously, whereas it had no effect on the expression level of TLR2.</p><p><b>CONCLUSIONS</b>Our data indicate that TLR4 may be the LPS signal transducer in endothelial cells and plays important roles in the cell activation of LPS. The ECV304 cell line is a better experimental model than isolated HUVECs in the research of endothelial cells.</p>
Sujets)
Humains , Lignée cellulaire , Relation dose-effet des médicaments , Protéines de Drosophila , Endothélium vasculaire , Biologie cellulaire , Métabolisme , Régulation de l'expression des gènes , Lipopolysaccharides , Pharmacologie , Glycoprotéines membranaires , Génétique , ARN messager , Génétique , Métabolisme , Récepteurs de surface cellulaire , Génétique , Facteurs temps , Récepteur de type Toll-2 , Récepteur de type Toll-4 , Récepteurs de type Toll , Veines ombilicales , Biologie cellulaire , Métabolisme , Régulation positiveRésumé
Objective To express and identify of Toll-like receptor 4 (TLR4) extracellular fragment in Pichia pastoris and to provide basis for the related researches. Methods The human TLR4 extracellular cDNA fragment was amplified by PCR and after confirming by DNA sequence analysis, was inserted into the Pichia pastoris expression vector pPIC9K containing AOX1 promoter and lead sequence of ? factor gene to form a pPIC9K/TLR4 extracellular recombinant expression plasmid. The recombinant plasmid was transformed into GS115 and high copies transformants were screened with G418. After being identified by colony PCR, transformants were cultured in flasks and induced by 1% methanol. The expression products were analyzed by SDS-PAGE and were identified by Western blot analysis. Results The sequencing showed that TLR4 extracellular gene was identical to that in Genbank. The analysis for the recombinant plasmid DNA digested by enzyme demonstrated that the recombinant expression plasmids of pPIC9K/TLR4 extracellular were constructed successfully. After screening by G418, 200 high-copy-number of transformants were acquired. The special TLR4 extracellular gene segment was obtained by identification with colony PCR, which showed that TLR4 extracellular gene of 5 clones were inserted into Pichia pastoris. After methanol induction for 4 d, the expression proteins came up to 50.35% of total proteins in medium supernatant as shown by SDS-PAGE. Western blot analysis proved that the expression protein could bind to TLR4 monoclonal antibody specifically. Conclusion TLR4 extracellular protein is expressed and identified successfully by Pichia pastoris system, which can provide basis for the researches of further screening of high expression colony, protein purification, and functional research.
Résumé
An immunogenic peptide sequence of B cell dominant epitope of human Toll like receptor 4 (TLR4) was selected basing on predication of B cell epitope of TLR4.bALB/c mice were immunized with synthetic peptide of TLR 4 and one clone (B4) of hybridoma cells was picked out by ELISA and limited dilution. High titer McAb prepasations against TLR 4 were obtained from ascites fluid of BALB/c mice infravenously inoculated with the McAb inducing hybridoma cells.The titer of ascites fluid was 1∶ 100 000 .The subclass of the McAb was IgG2,k.The specificity of McAb was identified. by indirect ELISA,and a single strong blot was shown in molecular weights of 90 Kd.using Western blot analysis.