Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 12 de 12
Filtrar
1.
Chinese Journal of Perinatal Medicine ; (12): 218-221, 2022.
Artigo em Chinês | WPRIM | ID: wpr-933905

RESUMO

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

2.
Acta Pharmaceutica Sinica B ; (6): 516-525, 2019.
Artigo em Inglês | WPRIM | ID: wpr-774971

RESUMO

Secalonic acid D (SAD) could inhibit cell growth in not only sensitive cells but also multidrug resistant (MDR) cells. However, the molecular mechanisms need to be elucidated. Here, we identified that SAD possessed potent cytotoxicity in 3 pairs of MDR and their parental sensitive cells including S1-MI-80 and S1, H460/MX20 and H460, MCF-7/ADR and MCF-7 cells. Furthermore, SAD induced cell G2/M phase arrest the downregulation of cyclin B1 and the increase of CDC2 phosphorylation. Importantly, JNK pathway upregulated the expression of c-Jun in protein level and increased c-Jun phosphorylation induced by SAD, which was linked to cell apoptosis c-Jun/Src/STAT3 pathway. To investigate the mechanisms of upregulation of c-Jun protein by SAD, the mRNA expression level and degradation of c-Jun were examined. We found that SAD did not alter the mRNA level of c-Jun but inhibited its proteasome-dependent degradation. Taken together, these results implicate that SAD induces cancer cell death through c-Jun/Src/STAT3 signaling axis by inhibiting the proteasome-dependent degradation of c-Jun in both sensitive cells and ATP-binding cassette transporter sub-family G member 2 (ABCG2)-mediated MDR cells.

3.
Chinese Journal of Pathology ; (12): 527-530, 2018.
Artigo em Chinês | WPRIM | ID: wpr-806944

RESUMO

Objective@#To study the clinicopathologic characteristics, immunophenotype, pathologic diagnosis and differential diagnosis of myxoid adrenocortical adenomas.@*Methods@#The clinical data, histological features and immunohistochemical results of 4 cases of myxoid adrenocortical adenomas were analyzed, which were collected from January 2014 to December 2016 at Guangdong General Hospital, with review of literature.@*Results@#Four cases of myxoid adrenocortical adenomas were presented. The patients ages ranged from 26 to 45 years (mean =35 years). Microscopically, it showed a typical morphology, characterized by small-sized tumor cell cords or pseudo-glands embedded in an abundant extracellular myxoid matrix. Immunohistochemical staining showed tumor cells were strongly positive for Melan A, vimentin and focally for α-inhibin, one case showed strong and diffuse positivity for CAM5.2, and two cases showed diffuse positivity for synaptophysin, while negative for CgA, S-100 protein, epithelial antigen, CK7, CK20 and CKpan.@*Conclusions@#Myxoid adrenocortical adenomas are extremely rare, which may cause confusion with metastatic well-differentiated neuroendocrine tumours, sex cord-stromal tumoursor metanephric adenoma. Recognition of this entity would be beneficial for pathologists to avoid misdiagnosis, and unnecessary treatment.

4.
Chinese Journal of Biotechnology ; (12): 976-985, 2017.
Artigo em Chinês | WPRIM | ID: wpr-242213

RESUMO

Young leaves of Kabuli chickpea as well as soybean Xiangdou No.3, which are the current plants that studied in our laboratory were selected as materials. Effects on protoplasts yield and survival rate of different enzyme combination, concentration of D-Mannitol in enzyme combinations, pH of enzyme combinations and enzymolysis time are detected. The results showed that, the best condition for Xiangdou No.3 leaf protoplasts isolation is to rotate the cut materials for 6 hours in enyzme solution under temperature of 27 ℃ and rotate speed of 45 r/min for 6 h. Onozuka R-10 (0.5%), Hemicellulase (0.8%), Macerozyme R-10 (0.8%) in combination with Pectolyase Y-23 (0.4%) dissolving in CPW solution with MES (0.1%) and Mannitol (10%), pH 6.0 was found best for protoplasts isolation of Xiangdou No.3 leaves.The best condition for protoplasts isolation of Kabuli chickpea is to put the cut materials into enzymatic hydrolysate enzymolyse for 7 to 8 hours under temperature of 27 ℃ and rotate speed of 45 r/min on water bath shaker, the optimum combination of enzyme consists of Onozuka R-10 (0.5%), Hemicellulase (0.8%), Macerozyme R-10 (0.8%), MES (0.1%) and Mannitol (10%) dissolved in CPW solution with pH 4.8. The protoplasts prepared with the methods above are used in subcellular location and the effects show well.

5.
Modern Clinical Nursing ; (6): 67-70, 2017.
Artigo em Chinês | WPRIM | ID: wpr-614213

RESUMO

Objective To explore the effect of employee assistance program on male nurses' professional values and professional identity.Methods Fifty male nurses participated in the program by group counseling and individual counseling.The professional values scale (NPVS-R) and the occupational identity scale were used to investigate the changes in their professional values and occupational identity before and after the intervention.Result After intervention,the occupational values and occupational identity of male nurses were significantly better than before intervention (P<0.01).Conclusion The employee assistance program for male nurses can promote the formation of positive professional values and professional identity sense.

6.
Chinese Journal of Medical Imaging Technology ; (12): 1821-1823, 2017.
Artigo em Chinês | WPRIM | ID: wpr-664757

RESUMO

Objective To quantitatively observe the value of relationship between nodule and corresponding capsular with ultrasonography in assessment of malignant and benign thyroid nodules.Methods A total of 79 cases with subcapsular tumors of thyroid gland confirmed pathologically were analyzed retrospectively,and the relationship between tumors and capsule was analyzed.Longitudinal diameter of nodules (from the junction of nodule and capsule to the deepest of nodule,V) and distance from nodule protruding thyroid capsule to the highest point of nodule (L) were measured,and L/V was evaluated.Diagnostic efficiency of L/V in diagnosis of malignant thyroid nodule was evaluated.Results The average L/V of benign and malignant nodules was 0.241± 0.041 and 0.162± 0.054,respectively (t=-7.367,P<0.01).The area under ROC curve of L/V in diagnosis of benign and malignant thyroid nodules was 0.87 (P<0.01).When L/V=0.225,the sensitivity was 82.17%,and the specificity was 87.53%;when L/V=0.245,the sensitivity was 67.10 %,and the specificity was 95.12%.Conclusion Ultrasonography can clearly show the relationship between thyroid nodules and capsule,and L/V can be used for differential diagnosis of benign and malignant thyroid nodules.

7.
The Journal of Practical Medicine ; (24): 3694-3697, 2015.
Artigo em Chinês | WPRIM | ID: wpr-484562

RESUMO

Objective To investigate the expression of FGFR4 in lung adenocarcinoma tissue and its association with the prognosis of lung adenocarcinoma. Methods The expression FGFR4 in 128 lung adenocarcinoma tissue and the normal lung tissue was detected by the immunohistochemistry SP method.The relationship between the expression of FGFR4 in lung adenocarcinoma and the prognosis of lung adenocarcinoma was analyzed. Results The expression of FGFR4 protein in lung adenocarcinoma was significantly lower than that in the tumor-adjacent normal lung tissue (P 0.05), but was significantly and positively correlated with the degree of tumor differentiation and T stage, N stage and the clinical TNM stage of lung adenocarcinoma (P < 0.05).Kaplan-Meier survival test showed that the postoperative survival time in the high expression group of FGFR4 was significantly longer than that in the low FGFR4 expression group (P < 0.05). Conclusion The expression of FGFR4 protein in lung adenocarcinoma was significantly lower than that in the tumor-adjacent normal lung tissue. Postoperative survival time in the high FGFR4expression group was significantly longer than that in the low FGFR4 expression group.

8.
Chinese Journal of Biotechnology ; (12): 1709-1719, 2014.
Artigo em Chinês | WPRIM | ID: wpr-345552

RESUMO

High temperature and humidity stress during seed growth and development of spring soybean can result in seed deterioration in South China. We isolated two genes (GmSBP and GmSBPL) encoding putative SBP proteins from soybean (Glycine max (L.) Merr.) to study their biological functions and response to abiotic stress,. The two SBP proteins are hydrophilic and incomplete membrane ones. Real-time quantitative (RT-PCR) analysis reveals that the expression of the two genes in the developing seeds of the seed deterioration resistant cultivar Xiangdou No. 3 and sensitive cultivar Ningzhen No. 1 was significantly affected by high temperature and humidity treatment. Meanwhile, the levels of sucrose and soluble sugar in the developing seeds of both cultivars were also affected under high temperature and humidity stress. During seed growth and development, the expression of the two genes as well as the levels of sucrose and soluble sugar reached the highest at 30 days after flower. GmSBP2 and GmSBPL were found to be differentially expressed in different soybean tissues. Sub-cellular localization indicated that two genes were located in cytoplasm and cell membrane. Our results indicate that GmSBP2 and GmSBPL might be involved in the response to abiotic stress, which will enrich our understanding of pre-harvest seed deterioration and resistance in soybean from one side.


Assuntos
China , Regulação da Expressão Gênica de Plantas , Genes de Plantas , Proteínas de Membrana Transportadoras , Genética , Lectinas de Plantas , Genética , Reação em Cadeia da Polimerase em Tempo Real , Sementes , Proteínas de Soja , Genética , Glycine max , Genética , Estresse Fisiológico
9.
Chinese Journal of Ultrasonography ; (12): 769-772, 2014.
Artigo em Chinês | WPRIM | ID: wpr-475848

RESUMO

Objective To investigate the value of ultrasonic diagnosis on cervical lymph nodes metastasis regions and characteristics in thyroid carcinoma.Methods Ultrasound image of 290 patients with thyroid carcinoma were analyzed restrospectively.The cervical lymph node metastasis regions diagnosed by ultrasonography were compared with histopathologic results,and the ultrasound characteristics of metastasis lymph nodes were assessed.Results Among 290 patients,167 cases with cervical lymph node metastasis were comfirmed by pathology (57.6%),and 185 cases were detected by pre-operative ultrasound (63.8%).The region of thyroid carcinoma lymph node metastasis comfirmed by histopathology was most commonly the central region (54.1%),followed by the lateral neck (20.7%).The diagnostic rate of central region lymph node metastatic by pre-operative ultrasound was only 31.7%,which was sharply lower than that of lateral region (57.6%,P <0.05).However,the diagnostic specificity (72.8 %) was apparently higher than lateral region (35.9%,P <0.05).The ultrasonic characteristics of metastatic cervical lymph nodes included rounded shape,absence of echogenic hilus,presence of calcitication,hyperechogenicity and cystic change.Conclusions The cervical central region is the predominant region for thyroid carcinoma lymph node metastasis,and ultrasound diagnosis on central region lymph node metastasis possesses positive specificity but negative sensitivity.Improving ultrasound diagnostic accuracy on central lymph nodes metastasis would be of important clinical significance.

10.
Chinese Journal of Practical Nursing ; (36): 1-3, 2014.
Artigo em Chinês | WPRIM | ID: wpr-445029

RESUMO

Objective To investigate the influencing factors and preventive measures of postoperative wound infection in patients who undergo the aseptic surgery of urinary system.Methods Clinical data of 302 cases of patients underwent the aseptic surgery of the urinary system between January 2011 to May 2013 were reviewed and studied by Logistic regression analysis.Results Wound infection occurred in 17 cases,the incidence of wound infection was 5.6% among 302 patients in this study.Postoperative wound infection risk factors were open surgery,operative time ≥ 2 h,to replace the drainage bag every one or two days once,and with some other underlying diseases.Conclusions To strengthen the basic disease treatment,select endoscopic operation if the surgery and treatment of disease allowed,shorten the operation time,reduce the number of drainage tube and reduce the frequency of replacement of drainage bag may effectively prevent postoperative wound infection in patients who undergo the aseptic surgery of the urinary system.

11.
Chinese Journal of Ultrasonography ; (12): 889-892, 2014.
Artigo em Chinês | WPRIM | ID: wpr-466118

RESUMO

Objective To investigate the value of color Doppler ultrasonography in diagnosis and differential diagnosis of breast sclerosing adenosis (SA).Methods Preoperative sonography in 32 SA,99 invasive ductal carcinoma(IDC),51 ductal carcinoma in situ(DCIS) and 64 fibroadenoma(FA) confirmed by pathology were retrospectively analyzed.Results The average age of SA group was younger than IDC and DCIS groups',but older than FA group's (P <0.05).The focal maximum diameter of SA group was the smallest among all(P <0.05).All the SA sonograms showed solid hypoechoic lesions,with spiculate margin was less than IDC group and larger than DCIS and FA groups (P <0.05).Similar ultrasonic characteristics,such as irregular shape,unclear border,acoustic halos were seen in SA and DCIS groups (P >0.05),while IDC group showed the highest rate and FA group had the least(P <0.05).SA masses' uneven internal echo,calcification,posterior acoustic attenuation was higher than FA group(P <0.05),but less than IDC and DCIS groups(P >0.05).Meanwhile,A/T ratios(≥0.7) were higher than DCIS and FA groups,but less than IDC group(P >0.05).In addition,SA group had a similar detection rate of the internal blood flow with FA group(P >0.05),but less than the IDC and DCIS groups(P <0.05).Conelusions Ultrasonography has a significant clinical value in diagnosis and differential breast sclerosing adenosis.

12.
Journal of Southern Medical University ; (12): 212-215, 2013.
Artigo em Chinês | WPRIM | ID: wpr-322079

RESUMO

<p><b>OBJECTIVE</b>To study the different expressions of glypican-3 in lung squamous cell carcinoma and adenocarcinoma and explore the association of glypican-3 with the prognosis of the patients.</p><p><b>METHODS</b>Glypican-3 expression was detected immunohistochemically in the tumor tissues and adjacent tissues from 48 cases of lung squamous cell carcinoma and adenocarcinoma. Kaplan-Meier method and log-rank test were used for survival analysis of the patients.</p><p><b>RESULTS</b>Glypican-3 expression was detected in the tumor tissues in 29.2% (14/48) of the cases, but not in the adjacent tissues. Of the 22 patients with lung squamous cell carcinoma, 12 (54.5%) showed positive glypican-3 expression in the tumor tissue, a rate significantly higher than that in patients with lung adenocarcinoma [7.7% (2/26), P<0.01]. In all the glypican-3-positive cases, the tumor tissues showed stronger glypican-3 expression in cases with lymph node metastasis or poor tumor differentiation. Kaplan-Meier survival analysis did not indicate a significant correlation of glypican-3 expression with the prognosis of the lung cancer patients.</p><p><b>CONCLUSION</b>Patients with lung squamous cell carcinoma have higher glypican-3 expressions in the tumor tissues than those with lung adenocarcinoma, suggesting the value of glypican-3 protein as a potential marker to detect lung squamous cell carcinoma.</p>


Assuntos
Humanos , Adenocarcinoma , Metabolismo , Patologia , Carcinoma de Células Escamosas , Metabolismo , Patologia , Regulação Neoplásica da Expressão Gênica , Glipicanas , Metabolismo , Estimativa de Kaplan-Meier , Neoplasias Pulmonares , Metabolismo , Patologia , Inclusão em Parafina , Prognóstico
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA