Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Rare Inherited Cholestatic Disorders and Molecular Links to Hepatocarcinogenesis.

Hepatocellular carcinoma (HCC) is the most common primary liver cancer affecting adults and the second most common primary liver cancer affecting children. Recent years have seen a significant increase in our understanding of the molecular changes associated with HCC. However, HCC is a complex disease, and its molecular pathogenesis, which likely varies by aetiology, remains to be fully elucidated. Interestingly, some inherited cholestatic disorders that manifest in childhood are associated with early HCC development. This review will thus explore how three genes that are associated with liver disease in childhood (ABCB11, TJP2 and VPS33B) might play a role in the initiation and progression of HCC. Specifically, chronic bile-induced damage (caused by ABCB11 changes), disruption of intercellular junction formation (caused by TJP2 changes) and loss of normal apical-basal cell polarity (caused by VPS33B changes) will be discussed as possible mechanisms for HCC development.