ABSTRACT
The identification of species primordium has been one of the hot issues in the identification of traditional Chinese medicine. Sea snake is one of the most valuable Chinese medicinal materials in China. In order to understand the origin and varieties of sea snake in the market, we studied the molecular identification of 46 sea snakes by cytochrome B(Cytb). After comparison and manual correction, the sequence length was 582 bp, and the content of A+T(58.9%) was higher than that of G+C(41.1%). There exist 197 variable sites and 179 parsimony-informative sites of the sequence. There are 44 kinds of sequence alignment with consistency equal to 100%, and 2 kinds equal to 96%. A total of 408 Cytb effective sequences were downloaded from GenBank database, with a total of 68 species. Phylogenetic tree of a total of 454 sea snake sequences with the samples in this study were constructed by neighbor-joining trees and Bayesian inference method, respectively, which can identify 42 samples of medicinal materials, while 4 samples can not be identified because of their low node support. The results showed that the species of the sea snake medicine were at least from 2 genera and 5 species, namely, Aipysurus eydouxii, Hydrophis curtus, H. caerulescen, H. curtus, H. ornatus and H. spiralis. This study suggested that the original species of commercial sea snake are very complex and can provide insight into the identification of sea snakes.
Subject(s)
Animals , Bayes Theorem , China , Cytochromes b/genetics , Elapidae , Medicine, Chinese Traditional , PhylogenyABSTRACT
OBJECTIVE@#To study the single nucleotide polymorphisms (SNPs) in promoter region of the Jk gene and its allele frequency as well as distribution characteristics in the Chinese Han nationality population.@*METHODS@#127 blood samples containing 8 Jk(a-b-) and 119 samples (as control) taken randomly from voluntary blood donors of Chinese Han nationality persons in Shenzhen Blood Center were collected. The Kidd phenotypes were identified by using the serologic test and urea hemolysis test; the Jk promoter, exon 1-11 region and respective flanking area were amplified and sequenced, then the sequence information was analyzed.@*RESULTS@#8 Jk(a-b-) samples all carried JkB/JkB allele which belongs to 2 kind of Jk genotypes commonly observed in Chinese Han nationality population. 6 IVS5-1g>a and 2 896G>A were found in 8 Jk(a-b-) samples. Besides, all Jk(a-b-) samples were homozygous for JkB/JkB allele. Three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene were found and sequenceds calculation of allele and genotype frequencies showed that the result accorded with Hardy-Weinberg equilibrium, indicating that the population in this study possesses representative characteristics of the Chinese Han nationality population.@*CONCLUSION@#The polymorphism of the Jk gene occurs in promoter region. This study calculates the allele frequencies of three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene, and shows their distribution characteristics in distinct Kidd phenotypes. These findings provide the basic foundation for further population genetics research.
ABSTRACT
Bromodomain-containing proteins (BCPs) can specifically recognize acetylated lysine (KAc) in histones and other substrate proteins. Recently, several kinase inhibitors were found to inhibit bromodomains, such as the PLK1 inhibitor BI-2536 and the JAK2 inhibitor TG101209, which bind to BRD4 with IC50 values of 25 nmol·L-1 and 130 nmol·L-1, respectively. To obtain potent BRD4 inhibitors from inhibitor BI-2536, we used dihydroquinoxalin-2(1H)-one to replace the 7,8-dihydropteridin-6(5H)-one in BI2536. By exploring the structure-activity relationships of the new dihydroquinoxalin-2(1H)-one structures, we obtained a novel phenyl side chain series of BRD4 inhibitors. We identified several potent BRD4 inhibitors, especially compounds 16, 22, 28 and 29, which had IC50 values below 100 nmol·L-1 in fluorescence anisotropy (FA) assays, indicating this series of compounds are worth to fruther investigation.
ABSTRACT
<p><b>OBJECTIVE</b>To establish a method for determination of glycosyltransferase and to explore the enzyme A, B glycosyltransferase activity in human serum so as to lay the foundation for the determination of enzyme level and enzyme activity.</p><p><b>METHODS</b>The glycosyltransferase activity kit was used to draw phosphate standard curves in our laboratory. The A and B glycosyltransferase activity were determined by the standard curves.</p><p><b>RESULTS</b>The standard curves (y=2671.3x-0.596 R=0.9998) for determing glycosyltransferase activity suitable for use in our laboratory were drawn. At the same time the method was set up for determination of A, B glycosyltransferase in human serum.</p><p><b>CONCLUSION</b>The establised method of the determination of glycosyltransferase is suitable for common type of enzyme activity and suitable for the A, B glycosyltransferase in human serum.</p>
ABSTRACT
<p><b>OBJECTIVE</b>To detect the base sequences of all exons and part of introns in the GYPA gene of the glycophorin GPA and to investigate the polymorphism of M, N alleles in Chinese population.</p><p><b>METHODS</b>A total of 225 blood sample were randomly colleeted from unrelated Chinese volunteers and were detected by serology techniques. The primers were designed by self, the seguencing of GYPA gene related with sample exon 1-7 full length sequences of bases and intron-1-7 partial sequence was performed, the polymorphism of M, N gene mutation in mucleotide sequence was analysed.</p><p><b>RESULTS</b>The results of M and N genotyping were in agreement with the results of serological detection. The 23rd base of intron-2, the 55th base of intron-3, the 63rd base of intron-4, the 55th, 189th and 190th base of intron-6, the 712th base variation of exon-7 in the gene M and N were used to subdivide the gene M and N into the mutant M103, M201, M202, N101, N102, N103, N104, and N201. At the same time, it was found that 42th and 54th base were mutated, the base T was inserted between 59th and 60th base in the intron-2, the new mutations occurred in the alleles 28, 29, 65 and 102 in intron-3 in this study.</p><p><b>CONCLUSION</b>The polymorphism of the the Chinese population's GYPA gene occurs in all the exons and partly in the introns. The gene polymorphism of M and N blood group in Chinese population might provide the theoretical basis for the studies of clinical blood transfusion, human population genetics and molecular biology.</p>
Subject(s)
Humans , Alleles , Asian People , Blood Group Antigens , Blood Grouping and Crossmatching , Exons , Genotype , Glycophorins , Introns , Polymorphism, GeneticABSTRACT
<p><b>OBJECTIVE</b>The aim of the present study is to explore the effects of exhaustive exercise-induced oxidative stress on the antioxidant capacity and diformability of rat red blood cells.</p><p><b>METHODS</b>Rats were divided into three group (n = 10): sedentary control (C), exhaustive running exercise (ERE) and moderate running exercise (MRE) groups. Animals in the ERE group started treadmill running at a speed of 20 m/min speed with a 5% gradient, and reached a speed of 25 m/min with gradient 15% in 20 min. Running was continued until exhaustion. MRE group rats running at a speed of 20 m/min with a 5% gradient for 40 min. The levels of free thiol in erythrocyte membrane protein, lipidperoxidation levels and membrane protein components were analyzed. The red blood cell deformability of different groups was also observed.</p><p><b>RESULTS</b>The results showed that red blood cells were damaged by severe oxidative stress and the anti-oxidative capacity decreased significantly under exhaustive exercise conditions. Besides, lipid peroxidation and protein sulfhydryl cross-link based clustering of membrane were found after exhaustive exercise, and polymers high molecular weight (HMW) was formed. The elongation index (EI) was found to decline significantly in the ERE group compared with the C and MRE groups under shear stress (control group, 0.41 +/- 0.01 at 3 Pa and 0.571 +/- 0.008 at 30 Pa; ERE group, 0.314 +/- 0.013 at 3 Pa and 0.534 +/- 0.009 at 30 Pa; P < 0.05 and P < 0.01, respectively).</p><p><b>CONCLUSION</b>These exercise-induced oxidative injure result in a significant decrease in deformability of rat erythrocytes, which in turn leads to dysfunction in the microcirculatory.</p>
Subject(s)
Animals , Male , Rats , Disease Models, Animal , Erythrocyte Deformability , Fatigue , Metabolism , Oxidative Stress , Physical Conditioning, Animal , Rats, Sprague-DawleyABSTRACT
<p><b>BACKGROUND</b>The heme oxygenase/carbon monoxide (HO/CO) system plays an important role in the development of hepatic fibrosis. The level of the HO/CO can be directly obtained by determining the carboxyhemoglobin (COHb) level. The aims of this study were to reveal the significance of COHb in patients with hepatitis B virus-related cirrhosis (HBC) complicated by hepatic encephalopathy (HE), and to further investigate the influence of the HO/CO pathway on the end-stage cirrhosis, hoping to find a reliable indicator to evaluate the course of HBC.</p><p><b>METHODS</b>According to the diagnostic criteria, 63 HBC inpatients with HE were enrolled in group H. Patients regaining awareness with current therapies were categorized into group P-H. Comparisons were made with a control group (group N) consisting of 20 health volunteers. The levels of COHb, partial pressure of oxygen (PaO2) and oxygen saturation (SaO2) were determined by arterial blood gas analysis method. The incidences of hepatorenal syndrome (HRS), upper gastrointestinal bleeding, esophagogastric varices and spontaneous bacterial peritonitis (SBP) in group H were recorded. COHb levels in different groups were compared, and the correlations of COHb levels with HE grades (I, II, III, and IV), PaO2, SaO2 and hypoxemia were analyzed.</p><p><b>RESULTS</b>The COHb level in group P-H ((1.672 ± 0.761)%) was significantly higher than that in group N ((0.983 ± 0.231)%) (P < 0.01), and the level in group H ((2.102 ± 1.021)%) was significantly higher than groups P-H and N (P < 0.01). A positive correlation was observed between the COHb concentration and the grade of HE (r(s) = 0.357, P = 0.004). There were no significant differences of COHb levels between HE patients with and without complications such as esophagogastric varices ((2.302 ± 1.072)% vs. (1.802 ± 1.041)%, P > 0.05) or the occurrence of SBP ((2.960 ± 0.561)% vs. (2.030 ± 1.021)%, P > 0.05). Compared with HE patients with HRS, the level of COHb was significantly higher in HE patients without HRS ((2.502 ± 1.073)% vs. (1.981 ± 1.020)%, P = 0.029). The COHb level had a negative correlation with PaO2 (r = -0.335, P = 0.007) while no statistically significant relationship was found with SaO2 (r = -0.071, P > 0.05). However, when the above two parameters met the diagnostic criteria of hypoxemia, the COHb concentration increased ((2.621 ± 0.880)% vs. (1.910 ± 0.931)%, P = 0.011).</p><p><b>CONCLUSIONS</b>COHb is a potential candidate to estimate the severity and therapeutic effect of HE. The levels of COHb may be tissue-specific in cirrhotic patients with different complications.</p>
Subject(s)
Adult , Aged , Female , Humans , Male , Middle Aged , Carboxyhemoglobin , Metabolism , Fibrosis , Virology , Hepatic Encephalopathy , Metabolism , Hepatitis B virus , VirulenceABSTRACT
This study was purposed to investigate the molecular polymorphism of gypa gene in association with MN human blood group in Chinese Han population. The MN phenotypes of 202 random samples from unrelated Chinese Han volunteers were identified by serology techniques. The primer for gypa gene exon 2 were designed and synthesized according to reference sequences of NG-007470 gene from GenBank, the DNA of 202 samples was amplified by PCR, at the same time, the amplified products were analyzed by direct DNA sequencing. The results showed that all samples had 2 base substitutions at 1st and 56th nt of gypa exon 2, among them the MN phenotype heterozygote exited mainly in the form of 1A > C, 22T/C, 34A/G, 35T/G, 56T > C; the MM phenotype homozygote exited mainly in the form of 1A > C, 22C, 34G, 35T, 56T > C; the NN phenotype homozygote exited mainly in the form of 1A > C, 22T, 34A, 35G, 56T > C. It is concluded that the polymorphism of gypa gene in associated with MN blood group in Chinese Han population is decided by 5 nucleotide sites of 1, 22, 34, 35 and 56. The bases of 1 and 56 are non-functional gypa single nucleotide polymorphism.
Subject(s)
Humans , Asian People , Genetics , Base Sequence , Exons , Genotype , Glycophorins , Genetics , MNSs Blood-Group System , Genetics , Molecular Sequence Data , Polymorphism, Genetic , Sequence Analysis, DNAABSTRACT
In order to elucidate the expression and molecular genetic background of ABO gene seven samples with ABO discrepancy further identified as bi-specific ABO gene were studied. All these samples were subjected to phenotyping by monoclonal and polyclonal antisera and were then genotyped by direct DNA sequencing and haplotype-sequencing at the exon 6 and 7 of ABO gene. As a result, six ABO dual-specific alleles were identified in Chinese population. An antigen expressed by these B (A) or Cis-AB individuals varied from very low level to the normal level, compared with common A blood group samples. In conclusion, molecular genetic backgrounds of two pairs out of four samples in all samples were the same, however, the ABO expression showed diverse.
Subject(s)
Humans , ABO Blood-Group System , Genetics , Asian People , Genetics , DNA Mutational Analysis , Erythrocytes , Cell Biology , Metabolism , Exons , Genetics , Glycosyltransferases , Chemistry , GeneticsABSTRACT
In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.
Subject(s)
Humans , Alleles , Asian People , Genetics , Blood Donors , Blood Group Antigens , Genetics , Cell Adhesion Molecules , Genetics , Exons , Genetics , Homozygote , Polymorphism, Genetic , Sequence Analysis, DNAABSTRACT
<p><b>OBJECTIVE</b>Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.</p><p><b>METHODS</b>Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.</p><p><b>RESULTS</b>The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.</p><p><b>CONCLUSION</b>A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.</p>
Subject(s)
Humans , Alleles , Asian People , Genetics , Base Sequence , Ethnicity , Genetics , Fucosyltransferases , Genetics , Genotype , Pedigree , Phenotype , Polymerase Chain Reaction , Sequence Analysis, DNA , Serologic TestsABSTRACT
<p><b>OBJECTIVE</b>To study the distribution of ABO gene polymorphism in Uighur population in Xinjiang area of China.</p><p><b>METHODS</b>DNA was extracted from 160 Uygur unrelated donorso blood and PCR-sequence specific primer analysis was performed. Some difficult samples were further directly sequenced.</p><p><b>RESULTS</b>Six alleles were detected in a population of 160 Uighur individuals, the gene frequencies of which were 0.2062(A101), 0.0563(A102), 0.0156(A201), 0.0031(A205),0.1875(B01),0.5312(O01), respectively.</p><p><b>CONCLUSION</b>The characteristics for AB gene structure of Xinjiang Uighur suggests that genetic polymorphism is distinguished between Xinjiang Uighur nationality and Chinese Han nationality, and both of them have discrepancy and confluent characters.</p>
Subject(s)
Female , Humans , Male , ABO Blood-Group System , Genetics , Asian People , Genetics , Base Sequence , China , Ethnology , Ethnicity , Gene Frequency , Genetic Predisposition to Disease , Genotype , Polymorphism, GeneticABSTRACT
OBJECTIVE@#To study the molecular genetic background of Diego blood group in Chinese Han population.@*METHODS@#A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing.@*RESULTS@#Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19.@*CONCLUSION@#Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.
Subject(s)
Humans , Asian People/genetics , Base Sequence , Blood Donors , Blood Group Antigens/metabolism , Blood Grouping and Crossmatching/methods , China/ethnology , Exons/genetics , Genotype , Molecular Sequence Data , Phenotype , Polymerase Chain Reaction/methods , Sequence Analysis, DNAABSTRACT
In order to study the genetic status of a rare chimeric family, some samples of A(3)B(3) family were identified by sequencing of ABO gene; flow-rSSO and PCR-SSP were used to detect loci of HLA-A, B, DRB1 genes, and multiplex amplifying with fluorescence-dye were performed for 16 short tandem repeat (STR) loci. The results indicated that two individuals from A(3)B(3) family contained more than two alleles at ABO gene, HLA-B, DRB1 and some STR loci. In conclusion, analysis of chimeric blood group by using genotyping techniques clearly demonstrating genetic status of this rare chimeric blood group promotes further elucidation of the existing state of specific genetic status.
Subject(s)
Adult , Female , Humans , Male , ABO Blood-Group System , Genetics , Allergy and Immunology , Chimerism , Genotype , HLA-A Antigens , Genetics , HLA-B Antigens , Genetics , HLA-DR Antigens , Genetics , HLA-DRB1 Chains , Pedigree , Polymorphism, Genetic , Tandem Repeat Sequences , GeneticsABSTRACT
<p><b>OBJECTIVE</b>To study the ABO allele molecular characteristics of Ael blood subgroup.</p><p><b>METHODS</b>Five individuals of diagnosed as Ael blood subgroup were subjected to PCR amplify ABO alleles using four pairs of sequence-specific primers. Exon 6 and exon 7 at ABO locus of all samples were sequenced. An individual with AelB phenotype was chosen for further analysis of transcript structure of ABO gene.</p><p><b>RESULTS</b>Sequence analysis indicated one Ael phenotype sample with reported Ael01 allele, one Ael phenotype sample with an Ael05 allele, and two AelB and one Ael individuals did not contain referred A allele, but contain O01 or O02 allele with 261G deletion.</p><p><b>CONCLUSION</b>Molecular bases for the Ael have highly polymorphism. The mechanism responsible for the express weak A antigen of O allele with 261G deletion awaits to be elucidated.</p>
Subject(s)
Female , Humans , Male , ABO Blood-Group System , Genetics , Alleles , Base Sequence , Cloning, Molecular , DNA , Molecular Sequence Data , Polymerase Chain Reaction , Polymorphism, GeneticABSTRACT
To study four A(3) subgroup samples identified by serologic tests, among which two belong to a family, three were A(3) subgroup, one was A(3)B subgroup. All four samples were genotyped by PCR-SSP method, and the nucleotide sequences of Exon 6, Exon 7 and part introns at the ABO locus for these samples were detected by ABI Prism 3100 DNA sequencer. Comparison with the consensus of A101 was performed. The results showed that haplotypes of two A(3) subgroups were common A102 allele and O1-2 allele, and haplotypes of one A(3) subgroup were common A102 allele and rare O(1v)-4 allele. Unexpectedly, a synonymous substitution 838C-->T had been found in A allele of the A(3)B subgroup sample, which predict a Leu280Phe alteration. The results suggested that molecular genetic background of the A(3) phenotypes is polymorphic. Possibly, the missense mutation 838C-->T is the molecular genetic basis of A(3)B subgroup that lead to low activity of the glycosyltransferases.
Subject(s)
Humans , ABO Blood-Group System , Genetics , Alleles , Asian People , Genetics , Base Sequence , China , DNA Mutational Analysis , Exons , Genotype , Introns , Mutation , Phenotype , Polymerase Chain ReactionABSTRACT
Objective To identify novel ABO allele in Chinese population. Methods The ABO blood group was tested by serological method, and then genotyped by sequence-specific primer (PCR-SSP) , gene cloning and sequence analysis. Results A healthy blood dornor who was diagnosed as having A2 subgroup and A2O1genotype was subjected to ABO gene cloning and sequence analysis. The haplotype-specific sequence analysis indicate that two single-base deletions, where G-deletion at nucleotide position 261 and A-deletion at nucleotide position 496 were determined in the O1 allele. The nucleotide sequence of the novelO1 allele were identical to ABO 0101 allele except for A-deletion at nucleotide position 496 in exon7 of ABO locus. Conclusion We defined this 0 allele as a novel O1 variant allele, and its registered number by GenBank is AY374123.