ABSTRACT
@#Objective To develop and verify a double-antibody sandwich ELISA method for the detection of process-specific E.coli residual protein in recombinant biological preparations.Methods Taking the production and purification process of glucagon-like peptide(GLP)expressed by E.coli as the specific process model,the same process was used to intercept the residual protein of empty E.coli(normal E.coli that does not express recombinant protein). One female New Zealand white rabbit and six female Kunming mice were immunized with the residual protein as the immunogen. Using the IgG antibody purified from rabbit immune serum as the coating antibody,mouse immune serum as the second sandwich antibody,and antimouse IgG-HRP as the enzyme-labeled secondary antibody,a double antibody sandwich ELISA method for process-specific residual protein of E.coli was established. The specificity,accuracy and precision of the method were verified,and the limit of detection(LOD)was determined. Simultaneously,the developed method and the commercial E.coli host protein residue detection kit were used to quantitatively determine the residual protein of purified GLP preparation.Results After a series of gradient dilution of process-specific residual protein with known concentration,the sensitivity of this ELISA method reached 338 pg/mL. No cross reaction occurred in the detection of CHO and yeast cell lysis protein by this method,the recoveries of samples with low,medium and high concentrations were all in the range of 80% — 120%,and the intra-assay and inter-assay CVs of the empty E.coli interception standard with low,medium and high concentrations were all less than15%. For the residual protein in GLP preparation,about 62% of the residual proteins were not detected by the commercial non-process-specific ELISA kit compared with the total amount of residual proteins detected by the developed method,and these residual proteins should be the process-specific residual proteins.Conclusion The double antibody sandwich ELISA method developed in this study has high sensitivity,strong specificity,good accuracy and precision for the detection of process-specific E.coli residual protein,which can meet the detection requirements that the residual protein is less than0. 01% — 0. 1% in biological preparations.
ABSTRACT
@#ObjectiveTo optimize the condition for anion exchange chromatography in purification process of recombinant human growth hormone-Fc(rhGH-Fc)fusion protein by Design of Experiment(DOE)so as to decrease the content of host cell protein(HCP)in bulk of protein.MethodsA complete factorial experimental design with four factors at two levels was established by the DOE in Minitab 19 software.The condition(flow rate,sample load,pH value of buffer and salt concentration of eluent)for anion exchange chromatography in purification process of rhGH-Fc was optimized by DOE to find out the operating space.ResultsThe experimental results were predicted accurately by the established DOE model.The sample load,pH value of buffer,salt concentration of eluent as well as the interaction of pH value of buffer and salt concentration of eluent showed significant influence on the HCP content in the harvest.The optimal sample load,flow rate as well as pH value and salt concentration of eluent were 15 mg/mL,120 cm/h,7.0 ～ 8.0 and 0.1 mol/L respectively.The HCP contents in eluents under the optimal condition were less than 400 ng/mg,which met the requirements for verification within the range of results in determined operating space.ConclusionThe condition for removal of HCP by anion exchange chromatography was successfully optimized by DOE,which provided a reference for further application of DOE in the biopharmaceutical field.
ABSTRACT
@#Objective To develop and verify a quantitative real-time PCR method for determination of the content of host cell DNA residues in severe acute respiratory symptom coronavirus 2(SARS-CoV-2) inactivated vaccine(Vero cells),in order to better control the safety of products.Methods DNA was extracted from inactivated SARS-CoV-2 vaccine(Vero cells) bulk by magnetic bead separation method,and the DNA residues of host cells were quantitatively analyzed by probetype PCR.The linear range,repeatability,intermediate precision,quantitative limit,specificity,durability and accuracy of the developed method were verified,and the host cell DNA re sidues of 5 batches of inactivated SARS-CoV-2 vaccine(Vero cells)were determined by this method.Results DNA standard curve showed good linearity in the range of 300～0.003 pg/μL(each R~2> 0.99);Relative standard deviations(RSD) of repeatability and intermediate precision verification were less than 20%;The quantitative limit was 0.001 pg/μL;Sample dilution and purified liquid dilution had no interference to detection;The results of 60 min incubation at 53,55,57 ℃ and 56,60,64 min incubation at 55 ℃ showed no significant difference;The recoveries of accuracy verification were 79%～83%,RSD <5%.This method had good adaptability in detecting DNA residues in the bulk of inactivated SARS-CoV-2 vaccine(Vero cells).Conclusion The quantitative realtime PCR method for determination of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells) has been successfully developed,of which the linearity and range,repeatability,intermediate precision,quantitative limit,specificity,durability and accuracy meet the acceptable standards,and are suitable for the detection and quality control of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells).
ABSTRACT
Monitoring of host cell proteins(HCPs)during the manufacturing of monoclonal antibodies(mAb)has become a critical requirement to provide effective and safe drug products.Enzyme-linked immunosor-bent assays are still the gold standard methods for the quantification of protein impurities.However,this technique has several limitations and does,among others,not enable the precise identification of pro-teins.In this context,mass spectrometry(MS)became an alternative and orthogonal method that de-livers qualitative and quantitative information on all identified HCPs.However,in order to be routinely implemented in biopharmaceutical companies,liquid chromatography-MS based methods still need to be standardized to provide highest sensitivity and robust and accurate quantification.Here,we present a promising MS-based analytical workflow coupling the use of an innovative quantification standard,the HCP Profiler solution,with a spectral library-based data-independent acquisition(DIA)method and strict data validation criteria.The performances of the HCP Profiler solution were compared to more con-ventional standard protein spikes and the DIA approach was benchmarked against a classical data-dependent acquisition on a series of samples produced at various stages of the manufacturing process.While we also explored spectral library-free DIA interpretation,the spectral library-based approach still showed highest accuracy and reproducibility(coefficients of variation＜10％)with a sensitivity down to the sub-ng/mg mAb level.Thus,this workflow is today mature to be used as a robust and straightforward method to support mAb manufacturing process developments and drug products quality control.
ABSTRACT
In response to the market demand for therapeutic antibodies, the upstream cell culture scale and expression titer of antibodies have been significantly improved, while the production efficiency of downstream purification process is relatively fall behind, and the downstream processing capacity has become a bottleneck limiting antibody production throughput. Using monoclonal antibody mab-X as experimental material, we optimized the caprylic acid (CA) precipitation process conditions of cell culture fluid and low pH virus inactivation pool, and studied two applications of using CA treatment to remove aggregates and to inactivate virus. Based on the lab scale study, we carried out a 500 L scale-up study, where CA was added to the low pH virus inactivation pool for precipitation, and the product quality and yield before and after precipitation were detected and compared. We found that CA precipitation significantly reduced HCP residuals and aggregates both before and after protein A affinity chromatography. In the aggregate spike study, CA precipitation removed about 15% of the aggregates. A virus reduction study showed complete clearance of a model retrovirus during CA precipitation of protein A purified antibody. In the scale-up study, the depth filtration harvesting, affinity chromatography, low pH virus inactivation, CA precipitation and depth filtration, and cation exchange chromatography successively carried out. The mixing time and stirring speed in the CA precipitation process significantly affected the CA precipitation effect. After CA precipitation, the HCP residue in the low pH virus inactivation solution decreased 895 times. After precipitation, the product purity and HCP residual meet the quality criteria of monoclonal antibodies. CA precipitation can reduce the chromatography step in the conventional purification process. In conclusion, CA precipitation in the downstream process can simplify the conventional purification process, fully meet the purification quality criterion of mab-X, and improve production efficiency and reduce production costs. The results of this study may promote the application of CA precipitation in the purification of monoclonal antibodies, and provide a reference for solving the bottleneck of the current purification process.
Subject(s)
Cricetinae , Animals , Antibodies, Monoclonal/metabolism , Caprylates/chemistry , Cell Culture Techniques , Chromatography, Affinity , CHO Cells , Cricetulus , Chemical PrecipitationABSTRACT
Ensuring the removal of host cell proteins (HCPs) during downstream processing of recombinant pro-teins such as monoclonal antibodies (mAbs) remains a challenge.Since residual HCPs might affect product stability or safety,constant monitoring is required to demonstrate their removal to be below the regulatory accepted level of 100 ng/mg.The current standard analytical approach for this procedure is based on ELISA;however,this approach only measures the overall HCP content.Therefore,the use of orthogonal methods,such as liquid chromatography-mass spectrometry (LC-MS),has been established,as it facilitates the quantitation of total HCPs as well as the identification and quantitation of the indi-vidual HCPs present.In the present study,a workflow for HCP detection and quantitation using an automated magnetic bead-based sample preparation,in combination with a data-independent acquisi-tion (DIA) LC-MS analysis,was established.Employing the same instrumental setup commonly used for peptide mapping analysis of mAbs allows for its quick and easy implementation into pre-existing workflows,avoiding the need for dedicated instrumentation or personnel.Thereby,quantitation of HCPs over a broad dynamic range was enabled to allow monitoring of problematic HCPs or to track changes upon altered bioprocessing conditions.
ABSTRACT
Studies have confirmed that microRNA (miRNAs) is involved in the development and progression of tumors by targeting multiple genes. However, the molecular mechanism of miR-654-5p in in- hibiting the invasion and metastasis of breast cancer cells through the targeted regulation of host cell factor 1 (HCFCl) is still unclear. The analysis of bioinformatics datasets found that miR-654-5p was downregu-lated in breast cancer tissues and was associated with poor prognosis (P = 0. 013). Quantitative real-time PCR (Quantitative real-time PCR, qRT-PCR) showed that the expression of miR-654-5p in MDA-MB-231 cells was decreased (P<0. 05), and the expression of miR-654-5p was significantly increased after transfection of the overexpressed plasmid (P<0. 05) as compared with the control group. The 5-Ethynyl-2'-deoxyuridine (EdU) proliferation experiment and Transwell assay showed that overexpression of miR-654-5p inhibited the proliferation, migration and invasion of MDA-MB-231 cells (P<0. 05). Hub gene HCFCl of miR-654-5p was screened and constructed by Cytoscape software, and it was found that miR-654-5p was negatively correlated with the expression of HCFCl. The expression of HCFCl was increased in breast cancer tissues and closely correlated with lymph node metastasis, and patients with high expression of HCFCl had poor prognosis (P = 0. 0039). Dual-luciferase assay confirmed that miR-654-5p could bind to the 3'-UTR of HCFClmKNA (P<0. 05). Western blot results showed that compared with human normal breast epithelial cells MCF-10A, the expression of HCFCl was increased in MDA-MB-231 cells (P<0. 05), and the expression of HCFCl was significantly down-regulated after overexpression of miR-654-5p (P<0. 05). Transwell experiment results showed that the migration and invasion ability of MDA-MB-231 cells after overexpression of miR-654-5p was significantly decreased compared with the control group. Co-transfection of HCFCl can partially reverse the inhibitory effect of miR-654-5p on the migration and invasion ability of breast cancer cells (P<0. 05). In conclusion, miR-654-5p can inhibit the proliferation, invasion and metastasis of breast cancer cells by regulating the expression of HCFCl.
ABSTRACT
Objective To reduce the residual proteins and DNA of host cells in the preparation of H5N1 influenza A virus. Methods Core 700 was firstly used to remove residual host cell proteins, and then Capto Q was used to remove host cell DNA. Several batches of H5N1 influenza A virus cultured in Ma-din-Darby canine kidney ( MDCK) cells were purified using this method. The efficiency of purification was evaluated using many methods including quantitative real-time PCR, hemagglutination ( HA) test and single radial immunodiffusion assay. Moreover, Benzonase nuclease was used for comparison. Results Without the use of Benzonase nuclease, the overall removal rates of host cell DNA and residual proteins were 99. 62％ and 98. 1％, and the HA antigen recovery rate was 66. 96％. Conclusions This study established a purification strategy with good effect for cell-based influenza vaccines. It can efficiently remove host cell DNA and proteins and achieve a high HA recovery rate. The purification result is no worse than that of adding Benzonase nuclease, suggesting the potential of its application in actual vaccine production.
ABSTRACT
Objective@#To reduce the residual proteins and DNA of host cells in the preparation of H5N1 influenza A virus.@*Methods@#Core 700 was firstly used to remove residual host cell proteins, and then Capto Q was used to remove host cell DNA. Several batches of H5N1 influenza A virus cultured in Madin-Darby canine kidney (MDCK) cells were purified using this method. The efficiency of purification was evaluated using many methods including quantitative real-time PCR, hemagglutination (HA) test and single radial immunodiffusion assay. Moreover, Benzonase nuclease was used for comparison.@*Results@#Without the use of Benzonase nuclease, the overall removal rates of host cell DNA and residual proteins were 99.62% and 98.1%, and the HA antigen recovery rate was 66.96%.@*Conclusions@#This study established a purification strategy with good effect for cell-based influenza vaccines. It can efficiently remove host cell DNA and proteins and achieve a high HA recovery rate. The purification result is no worse than that of adding Benzonase nuclease, suggesting the potential of its application in actual vaccine production.
ABSTRACT
OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.
ABSTRACT
Therapeutic monoclonal antibodies become the major product class within the biopharmaceutical market. Protein A as the first capture step is still dominant in current platforms for purification of monoclonal antibodies. In this study, we developed a new antibody harvest process that incorporates acidic treatment of cell harvest, demonstrating high process yield, improved clearance of host cell associated contaminants, like non-histone host cell protein, histone, DNA and heteroaggregates. Host protein contamination was reduced about 10-fold compared to protein A loaded with harvest clarified by centrifugation and microfiltration. Turbidity increase of eluted IgG upon pH neutralization was nearly eliminated. Residual levels of impurities in the protein A eluate were achieved that potentially meet requirements of drug substance and thus alleviate the burden for further impurities removal in subsequent chromatography steps. The mechanism of host cell associated contaminants removal during acidic treatment was also explored. After a polishing step by Capto adhere, host cell protein was reduced to less than 5 ppm, DNA less than 1 ppb, histone to undetectable level, heteroaggregates less than 0.01% with total IgG recovery around 87%. This efficient process can be easily integrated into current IgG purification platforms, and may overcome downstream processing challenges.
Subject(s)
Antibodies, Monoclonal , Biotechnology , Chromatography, Affinity , DNA , Histones , Hydrogen-Ion Concentration , Immunoglobulin G , Staphylococcal Protein A , ChemistryABSTRACT
OBJECTIVE: To compare the detection ability of three types of residual Chinese hamster ovary(CHO) host cell protein (HCP) ELISA kits (Cat No. A, B, C) from one manufacturer. METHODS: Residual CHO-HCP in the bulks of therapeutic monoclonal antibody (mcAb) produced with different strains of CHO cells, extracted proteins from CHO-K1 cultural supernatant and standards from different kits were determined with three types of kits to evaluate the CHO-HCP detection ability of different kits. Furthermore, the capture antibody coated microplates and enzyme conjugated detection antibody of three kits were re-assembled to detect standards and extracted supernatant proteins to analyze the possible reasons of differentiated detection ability. RESULTS: For the detection of mcAb samples, the relative recoveries of kit A and B to kit C were 1.89% and 15.34%, respectively; for the detection of extracted proteins from CHO-K1 cultural supernatant, the recoveries of kit A, B, and C were 4.05%, 21.52%, and 35.98%, respectively; for the detection of self-standards, the recoveries of three kits were all within the range of (100±15)%. For the detection of standards from other kits, there was a great discrepancy among the three kits. For kit A detection, the recoveries of standard B and C were 31.28% and 7.99%; for kit B detection, the recoveries of standard A and C were 55.76% and 25.08%; for kit C detection, the recoveries of standard A and B were 266.65% and 73.31%, respectively. By analyzing the results from reassembled capture and secondary antibodies, it was inferred that the detection ability of the capture antibodies of the three kits was sequenced as A>C>B, while the detection ability of enzyme conjugated secondary antibodies was sequenced as B>C>A. CONCLUSION: The detection abilities of three CHO-HCP ELISA kits from the investigated manufacturer were determined as C>B>A.
ABSTRACT
Rhoptry proteins are the major virulence factors of Toxoplasma gondii. They locate in different parts of the host cells and can affect the membrane cytoskeleton structure and active factors of the host cells so as to block the cell intrinsic de-fense mechanisms of the host and let T. gondii invade parasitize and proliferate in the host successfully. The function and ac-tion mode of rhoptry proteins reflect the pathogenic mechanism of T. gondii which holds great significance to looking for toxo-plasmosis drug targets and developing molecule vaccines. This paper reviews the research progess of the interaction between rhoptry proteins of T. gondii and host cells.
ABSTRACT
Objective To investigate whether the malignant transformation of macrophages ( Mφ) in glioma mesenchyme was induced by the fusion of glioma cells ( SU3 ) and Mφ.Methods SU3 cells transfected with red fluorescent protein genes were co-cultured in vitro with Mφexpressing enhanced green fluorescent protein.The cell lineages with RFP+/GFP+dual-color fluorescence were established by using monoclonal selection method.A series of tests for analyzing cancer-related phenotypes, tumorigenicity and specific markers for murine macrophage were performed.Results (1) A few of dual-color fluorescent cells were observed in the co-culture.Three monoclonal cell lineages (C3, C4 and C12) were obtained success-fully.(2) Three types of cells including RFP+, EGFP+and RFP+/EGFP+cells were formed during the cul-ture of monoclonal C12 cell lineage.The percentage of EGFP+cells was increased along the extended culture time and increased passages.Then, EGFP+cells gradually became the predominant cell population.Nota-bly, the percentage of RFP+/EGFP+cells were decreased and maintained at a low level, but the RFP+cells almost disappeared.(3) EGFP+cells from monoclonal C12 cell lineage showed the malignant characteristics such as loss of contact inhibition, rapid proliferation andchromosome aneuploidy, as well as high tumorigenic rate in nude mice (5/5).They also expressed macrophage specific marker CD68 and showed a large number of telocentric chromosomes.Conclusion The results of this study suggested that the malignant transforma-tion of host macrophages as previously observed in solid tumor might be induced by cell fusion occurred be-tween human glioma cells and macrophages.Along with the previous evidences showing the isolation of the malignantly transformed macrophages ( ihCTC) from solid tumor tissue of tumor-bearing mice, the results confirmed an objective existence of malignant transformation of host macrophages in tumor microenvironment. The malignant transformation of host cells induced by fusion with tumor cells revealed not only a new under-standing for the progression of tumor and cancer heterogeneity, but also new targets for cancer therapy.
ABSTRACT
The enteric protozoan parasite Entamoeba histolytica is the causative agent of human amebiasis. During infection, adherence of E. histolytica through Gal/GalNAc lectin on the surface of the amoeba can induce caspase-3-dependent or -independent host cell death. Phosphorylinositol 3-kinase (PI3K) and protein kinase C (PKC) in E. histolytica play an important function in the adhesion, killing, or phagocytosis of target cells. In this study, we examined the role of amoebic PI3K and PKC in amoeba-induced apoptotic cell death in Jurkat T cells. When Jurkat T cells were incubated with E. histolytica trophozoites, phosphatidylserine (PS) externalization and DNA fragmentation in Jurkat cells were markedly increased compared to those of cells incubated with medium alone. However, when amoebae were pretreated with a PI3K inhibitor, wortmannin before being incubated with E. histolytica, E. histolytica-induced PS externalization and DNA fragmentation in Jurkat cells were significantly reduced compared to results for amoebae pretreated with DMSO. In addition, pretreatment of amoebae with a PKC inhibitor, staurosporine strongly inhibited Jurkat T cell death. However, E. histolytica-induced cleavage of caspase-3, -6, and -7 were not inhibited by pretreatment of amoebae with wortmannin or staurosporin. In addition, we found that amoebic PI3K and PKC have an important role on amoeba adhesion to host compartment. These results suggest that amebic PI3K and PKC activation may play an important role in caspase-independent cell death in Entamoeba-induced apoptosis.
Subject(s)
Humans , Apoptosis , Caspases/metabolism , Entamoeba histolytica/enzymology , Hydrolysis , Jurkat Cells , Phosphatidylinositol 3-Kinases/metabolism , Protein Kinase C/metabolism , T-Lymphocytes/parasitologyABSTRACT
Entamoeba histolytica, which causes amoebic colitis and occasionally liver abscess in humans, is able to induce host cell death. However, signaling mechanisms of colon cell death induced by E. histolytica are not fully elucidated. In this study, we investigated the signaling role of NOX in cell death of HT29 colonic epithelial cells induced by E. histolytica. Incubation of HT29 cells with amoebic trophozoites resulted in DNA fragmentation that is a hallmark of apoptotic cell death. In addition, E. histolytica generate intracellular reactive oxygen species (ROS) in a contact-dependent manner. Inhibition of intracellular ROS level with treatment with DPI, an inhibitor of NADPH oxidases (NOXs), decreased Entamoeba-induced ROS generation and cell death in HT29 cells. However, pan-caspase inhibitor did not affect E. histolytica-induced HT29 cell death. In HT29 cells, catalytic subunit NOX1 and regulatory subunit Rac1 for NOX1 activation were highly expressed. We next investigated whether NADPH oxidase 1 (NOX1)-derived ROS is closely associated with HT29 cell death induced by E. histolytica. Suppression of Rac1 by siRNA significantly inhibited Entamoeba-induced cell death. Moreover, knockdown of NOX1 by siRNA, effectively inhibited E. histolytica-triggered DNA fragmentation in HT29 cells. These results suggest that NOX1-derived ROS is required for apoptotic cell death in HT29 colon epithelial cells induced by E. histolytica.
Subject(s)
Humans , Cell Death , Cell Line , Entamoeba histolytica/pathogenicity , Epithelial Cells/metabolism , Host-Pathogen Interactions , NADPH Oxidases/metabolism , Reactive Oxygen Species/metabolism , Signal TransductionABSTRACT
Trichomonas vaginalis and Tritrichomonas foetus are parasitic, flagellated protists that inhabit the urogenital tract of humans and bovines, respectively. T. vaginalis causes the most prevalent non-viral sexually transmitted disease worldwide and has been associated with an increased risk for human immunodeficiency virus-1 infection in humans. Infections by T. foetus cause significant losses to the beef industry worldwide due to infertility and spontaneous abortion in cows. Several studies have shown a close association between trichomonads and the epithelium of the urogenital tract. However, little is known concerning the interaction of trichomonads with cells from deeper tissues, such as fibroblasts and muscle cells. Published parasite-host cell interaction studies have reported contradictory results regarding the ability of T. foetus and T. vaginalis to interact with and damage cells of different tissues. In this study, parasite-host cell interactions were examined by culturing primary human fibroblasts obtained from abdominal biopsies performed during plastic surgeries with trichomonads. In addition, mouse 3T3 fibroblasts, primary chick embryo myogenic cells and L6 muscle cells were also used as models of target cells. The parasite-host cell cultures were processed for scanning and transmission electron microscopy and were tested for cell viability and cell death. JC-1 staining, which measures mitochondrial membrane potential, was used to determine whether the parasites induced target cell damage. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labelling staining was used as an indicator of chromatin damage. The colorimetric crystal violet assay was performed to ana-lyse the cytotoxicity induced by the parasite. The results showed that T. foetus and T. vaginalis adhered to and were cytotoxic to both fibroblasts and muscle cells, indicating that trichomonas infection of the connective and muscle tissues is likely to occur; such infections could cause serious risks to the infected host.
Subject(s)
Animals , Chick Embryo , Humans , Mice , Cell Adhesion/physiology , Fibroblasts/parasitology , Host-Parasite Interactions/physiology , Muscle Cells/parasitology , Trichomonas vaginalis/physiology , Tritrichomonas foetus/physiology , In Situ Nick-End LabelingABSTRACT
Entamoeba histolytica is an enteric tissue-invading protozoan parasite that can cause amebic colitis and liver abscess in humans. E. histolytica has the capability to kill colon epithelial cells in vitro; however, information regarding the role of calpain in colon cell death induced by ameba is limited. In this study, we investigated whether calpains are involved in the E. histolytica-induced cell death of HT-29 colonic epithelial cells. When HT-29 cells were co-incubated with E. histolytica, the propidium iodide stained dead cells markedly increased compared to that in HT-29 cells incubated with medium alone. This pro-death effect induced by ameba was effectively blocked by pretreatment of HT-29 cells with the calpain inhibitor, calpeptin. Moreover, knockdown of m- and micro-calpain by siRNA significantly reduced E. histolytica-induced HT-29 cell death. These results suggest that m- and micro-calpain may be involved in colon epithelial cell death induced by E. histolytica.
Subject(s)
Humans , Calpain/antagonists & inhibitors , Cell Death , Cell Line , Cell Survival/drug effects , Dipeptides/metabolism , Entamoeba histolytica/pathogenicity , Epithelial Cells/parasitology , Gene Knockdown TechniquesABSTRACT
In this paper, we provide evidence that both the mRNA and protein levels of the cyclin-dependent kinase (CDK) inhibitor p21WAF1/CDK-interacting protein 1 (Cip1) increase upon infection of A431 cells with Vaccinia virus (VACV). In addition, the VACV growth factor (VGF) seems to be required for the gene expression because infection carried out with the mutant virus VACV-VGF- revealed that this strain was unable to stimulate its transcription. Our findings are also consistent with the notion that the VGF-mediated change in p21WAF1/Cip1 expression is dependent on tyrosine kinase pathway(s) and is partially dependent on mitogen-activated protein kinase/extracellular-signal regulated kinase 1/2. We believe that these pathways are biologically significant because VACV replication and dissemination was drastically affected when the infection was carried out in the presence of the relevant pharmacological inhibitors.
Subject(s)
Humans , /metabolism , Vaccinia virus/physiology , Cell Line, Tumor , /genetics , Gene Expression Regulation, Viral/genetics , Mitogen-Activated Protein Kinases/metabolism , Protein-Tyrosine Kinases/genetics , Protein-Tyrosine Kinases/metabolism , RNA, Messenger/genetics , RNA, Messenger/metabolism , Signal Transduction/genetics , Virus Replication/geneticsABSTRACT
Historically, scientists in Brazil has significantly contributed to the biology, cultivation and structural organization of the pathogenic protozoan Toxoplasma gondiiand its interaction with host cells, starting with the description of the protozoan by Splendore in 1908. The intracellular and extracellular corpuscoli observed in rabbits, corresponded to what we now as tachyzoites. Later on, a pioneering method to grow T. gondii in tissue cultures was developed by Guimarães and Meyer, 1942. They also observed for the first time T. gondii by transmission electron microscopy and made the initial description of the cytoskeleton of T. gondii by observing negatively stained cells. In the 1980's, the relation of the cytoskeleton with the sub-pellicular microtubules was reveled by freeze-fracture. More recently, several Brazilian groups have analyzed in detail basic aspects of the early interaction of the protozoan with the host cell, such as the role of protein phosphorylation, transfer of host cell surface components to the protozoan and genesis and organization of the parasitophorous vacuole. Tachyzoites strategically inhibit nitric oxide production during active invasion of activated macrophages. In vitro studies on the sexual cycle of T. gondii using primary cultures of cat enterocytes and the egress from host cells are being carried out. Perspectives are that the contribution of Brazilian science to the knowledge on T. gondii biology will continue to flourish in years to come.