[Epidemiological study and serotyping by multiple PCR of Listeria monocytogenes isolated from food matrices in Argentina]. / Estudio epidemiológico y serotipificación por PCR múltiple de Listeria monocytogenes aislada de matrices alimentarias en Argentina.

Listeria monocytogenes is an opportunistic foodborne pathogen. It can resist stress conditions by adapting through the production of biofilms, which represents a serious problem for the food industry. It is classified into 14 serotypes, although only four (1/2a, 1/2b, 1/2c, and 4b) account for 89.0-98.0% of listeriosis cases worldwide. The objective of this study was to detect and serotype L.monocytogenes isolated from different food matrices from processing plants in Argentina. In the period 2016-2021, 1832 samples (meat, ready-to-eat foods, ice cream, dairy foods, and frozen vegetables) were analyzed, of which 226 (12.34%) isolates compatible with L.monocytogenes were detected. At the same time, environmental and surface samplings were performed in processing plants for ready-to-eat foods, sausages and dairy products, where environmental contamination with L.monocytogenes was detected in numerous critical points of the process, yielding a positivity rate of 22.7%. The molecular analysis of serogroups was performed, where it was observed that serogroup IIb was the most frequent with 66.5% (n=107), and in descending order IIc with 22.3% (n=36), and IIa (n=9) and IVb (n=9) with 5.6%. The serogroup mostly isolated in environmental monitoring was IIb. This work highlights the importance of the detection and serotyping of L.monocytogenes for taking actionable measures and identifying outbreaks, and is the first study in Argentina to describe an extensive study in food matrices.

Risk factors for listeriosis due to sausage consumption in Mexico: consumer practices, bacterial survival, and quantitative microbial risk assessment.

Listeriosis is a foodborne disease caused by Listeria monocytogenes (Lm), which represents a public health problem. Lm has been identified as an important contaminating bacterium of ready-to-eat meat products (RTEM) in Mexico. The objective was to explore the risk factors for acquiring listeriosis due to sausage consumption by defining the consumer profile, evaluating the survival of Lm in sausage (5, 10, and 25 °C for 32 days) and performing a quantitative microbiological risk assessment. The survey of 100 participants revealed that the factors compromising the safety of the RTEM by the consumer are the extension of the shelf life. Acquiring packaged RTEM was observed as a safe habit. All respondents stated that they were unaware of listeriosis, but 18% reported infections linked to RTEM, mainly sausage. The sausage supports the growth of Lm, whose population increases in congruence with temperature (25 °C > 10 °C >5 °C) and storage time (P ≤ 0.05). The increase in temperature decreases the adaptation time (Lag25 °C = 1.0 h, Lag10 °C= 92.5 h, Lag5 °C = 226.1 h) and increases the growth rate (µ25 °C = 4.43 CFU/h, µ10 °C = 0.075 CFU/h, µ5 °C = 0.0026 CFU/h) of Lm on the sausage. The risk of listeriosis due to sausage consumption increased according to the increase in temperature: 5.53 × 10-8-1.42 × 10-5 (5 °C), 0.00616-0.111 (10 °C), and 0.109-1.00 (25 °C). Consumer education in the hygienic management of RTEM and information on associated pathogens will minimize the risk of disease.

Listeria monocytogenes from food and food industry environments with reduced susceptibility to benzalkonium chloride, sodium hypochlorite, and peracetic acid.

The growing number of Listeria monocytogenes strains displaying increased tolerance to sanitizers widely applied in the food industry is becoming a problem. The aims of this study were to evaluate the susceptibility of L. monocytogenes isolates from food and food industry environments to sanitizers (benzalkonium chloride, sodium hypochlorite, peracetic acid, and chlorhexidine) and heavy metals (cadmium chloride), as well as to investigate the presence of the main genes related to efflux pumps. All 82 isolates showed reduced susceptibility to benzalkonium chloride (MIC from 16 to 128 µg mL-1), sodium hypochlorite (MIC of ≥ 2048 µg mL-1), and peracetic acid (MIC from 512 to ≥ 2048 µg mL-1), while 22 isolates showed reduced susceptibility to cadmium chloride (MIC > 70 µg mL-1). Susceptibility to chlorhexidine was found (MIC from 2 to 16 µg mL-1). PCR-based analysis revealed that mdrl and lde genes were harbored by 14.6% (12/82) and 40.2% (33/82) of the isolates, respectively. This study demonstrates the presence of L. monocytogenes from food and food industry environments with reduced susceptibility to sanitizers commonly used in food processing environments, highlighting the importance of continuous monitoring of the tolerance profile of this microorganism to sanitizers, as well as the need for strict control of sanitation conditions in food industries.

Impact of temperature, soil type and compost amendment on the survival, growth and persistence of Listeria monocytogenes of non-environmental (food-source associated) origin in soil.

Listeria monocytogenes of varied sources including food-related sources may reach the soil. Associated food safety and environmental health risks of such contamination depend significantly on the capacity of L. monocytogenes to survive in the soil. This study assessed the survival of 13 L. monocytogenes strains isolated from food and food processing environments and a cocktail of three of the strains in two types of soils (loam and sandy) under controlled temperature conditions: 5, 10, 20, 25, 30℃ and 'uncontrolled' ambient temperature conditions in a tropical region. The impact of compost amendment on the survival of L. monocytogenes in the two different types of soils was also assessed. Soil type, temperature and compost amendment significantly (P <0.001) impacted the survival of L. monocytogenes in soil. Temperature variations affected the survival of L. monocytogenes in soil, where some strains such as strain 732, a L. monocytogenes 1/2a strain survived better at lower temperature (5°C), for which counts of up to 10.47 ± 0.005 log CFU/g were recovered in compost-amended sandy soil, 60 days post-inoculation. Some other strains such as strain 441, a L. monocytogenes 1/2a survived best at intermediate temperature (25 and 30 °C), while others such as 2739 (L. monocytogenes 1/2b) thrived at higher temperature (between 30 °C - 37 °C). There were significant correlations between the influence of temperature and soil type, where lower temperature conditions (5°C - 20°C) were generally more suitable for survival in sandy soil compared to higher temperature conditions. For some of the strains that thrived better in sandy soil at lower temperature, Pearson correlation analysis found significant correlations between temperature and soil type. Steady, controlled temperature generally favored the survival of the strains compared to uncontrolled ambient temperature conditions, except for the cocktail. The cocktail persisted until the last day of post-inoculation storage (60th day) in all test soils and under all incubation temperature conditions. Loam soil was more favorable for the survival of L. monocytogenes and compost amendment improved the survival of the strains, especially in compost-amended sandy soil. Listeria monocytogenes may exhibit variable survival capacity in soil, depending on conditions such as soil type, compost amendment and temperature.

Growth behavior of low populations of Listeria monocytogenes on fresh-cut mango, melon and papaya under different storage temperatures.

The growth behavior of Listeria monocytogenes low population (1-4 cells/sample) on fresh-cut mango, melon, papaya and fruit mix stored at 4, 8, 12 and 16 °C was evaluated over 10 days. Mango showed the lowest counts for L. monocytogenes during 10 days regardless of storage temperature (<1.7 log cfu.g-1). Melon supported high bacterial growth over 10 days, reaching 5 log cfu.g-1 at 16 °C. Both the fruit and storage temperature influenced the Listeria low population growth potential (δ). Cumulative frequency distribution of L. monocytogenes showed that after 10 days, 100% of fresh-cut fruits and fruit mix stored at 4 °C remained ≤2 log cfu.g-1, while at 12 and 16 °C 100% of melon, papaya and fruit mix samples exceeded this limit. At 8 °C, 100% of mango and fruit mix samples remained below this limit after 10 days, whereas 100% of melon and papaya reached it after 7 days. Results indicate 4 °C as the ideal to store safely fresh-cut mango, melon, papaya and fruit mix for 10 days. Besides, 8 °C can also be an option, but not for melon and papaya. Findings highlight the ability of L. monocytogenes to survive and grow in fresh-cut fruits even at a very low initial population levels.

Pathogenic bacteria load and safety of retail marine fish / Carga de bactérias patogênicas e segurança de peixes marinhos de varejo

This study was conducted to determine the pathogenic bacteria load of 14 species of marine fish obtained from two suppliers (in Bitlis city, Turkey), which provide fish for fish markets, and to reveal the safety of the marine fish in terms of microbiological quality. The counts of total mesophilic aerobic bacteria (TMAB), Staphylococcus aureus, and Escherichia coli, the presence of Salmonella spp. and Listeria monocytogenes were determined in anchovy, horse mackerel, salmon, red mullet, gilthead seabream, bonito, pilchard, common sole, sand smelt, axillary seabream, seabass, Mediterranean horse mackerel, bluefish, and garpike. It was determined that common sole, axillary seabream, seabass, bluefish and Mediterranean horse mackerel obtained from both suppliers were unacceptable in terms of the counts of TMAB. Twenty-four samples exceeded the critical limit of S. aureus and all the samples were unacceptable according to the critical limit of E. coli. While L. monocytogenes was isolated from 50.0% of the samples, Salmonella spp. was isolated from 39.3% of the samples. These results showed that the pathogenic bacteria load of the analyzed marine fish was quite high and they were unsafe in terms of microbiological quality.

Este estudo foi realizado para determinar a carga de bactérias patogênicas de 14 espécies de peixes marinhos obtidos de dois fornecedores (na cidade de Bitlis, Turquia), que fornecem peixes para mercados de peixes, e para revelar a segurança do peixe marinho em termos de qualidade microbiológica. As contagens de bactérias aeróbias mesófilas totais (TMAB), Staphylococcus aureus e Escherichia coli, a presença de Salmonella spp. e Listeria monocytogenes foram determinados em anchova, carapau, salmão, salmonete, dourada, bonito, sardinha, linguado, cheirado, dourada-axilar, robalo, carapau-do-mediterrâneo, anchova e garpike. Foi determinado que o linguado, o dourada-axilar, o robalo, a anchova e o carapau-do-mediterrâneo obtidos de ambos os fornecedores eram inaceitáveis nas contagens do TMAB. Vinte e quatro amostras excederam o limite crítico de S. aureus, e todas as amostras foram inaceitáveis de acordo com o limite crítico de E. coli. Enquanto L. monocytogenes foi isolada em 50.0% das amostras, Salmonella spp. foi isolado de 39.3% das amostras. Esses resultados mostraram que a carga de bactérias patogênicas dos peixes marinhos analisados era bastante alta e eles eram inseguros em termos de qualidade microbiológica.

Effect of Lactobacillus rhamnosus on growth of Listeria monocytogenes and Staphylococcus aureus in a probiotic Minas Frescal cheese.

This study aimed to evaluate the effect of Lactobacillus rhamnosus GG on growth of Staphylococcus aureus and Listeria monocytogenes, inoculated alone or in combination on surface of Minas Frescal cheeses, during storage for 21 days at 7 °C. Survival percentages of each individual bacterial species after exposure to in vitro simulated gastrointestinal conditions (SGC) were also determined. The addition of L. rhamnosus did not affect (P > 0.05) pH, moisture, fat, protein and texture profile of Minas Frescal cheeses. L. rhamnosus was able to survive in suitable counts (>6 Log CFU/g) in cheeses from the 7th day of storage, with high survival (>74.6-86.4%) after SGC. An inhibitory effect of L. rhamnosus on L. monocytogenes was observed in cheeses (decrease of 1.1-1.6 Log CFU/g) and after SGC (20% reduction in the survival). No inhibitory effect of L. rhamnosus was observed on S. aureus counts (P > 0.05), and this microorganism did not survive the exposure to SGC. In conclusion, the addition of L. rhamnosus in Minas Frescal cheese has a potential for L. monocytogenes inhibition. Further studies are necessary to elucidate the mechanisms involved in the inhibition process and determine the survival ability of the bacterial species evaluated in in vivo experiments.

Lactobacillus acidophilus reduces Listeria monocytogenes infection by inhibiting mitogen-activated protein kinase genes in growing rabbits

We aimed to investigate the effect of Lactobacillus acidophilus ACCC11073 on the growth performance, oxidation, inflammation, and mitogen-activated protein kinase (MAPK) family genes of rabbits infected with Listeria monocytogenes (L. monocytogenes) using antibiotic enrofloxacin hydrochloride (EH) as a reference. There were four treatments including negative control, positive control with L. monocytogenes infection on the first day of feeding trial (PC), PC + EH at 40 mg kg−1, and PC + L. acidophilus at 108 CFU kg−1 of diet using 240 weaned growing rabbits. The results showed that L. monocytogenes infection worsened growth performance of rabbits, whereas EH or L. acidophilus supplementation partially recovered body weight gain, but did not reach the levels of the negative control. Listeria acidophilus and EH decreased L. monocytogenes loads in caecum, liver, spleen, and lymph node, serum oxidative markers including diamine oxidase, malondialdehyde, and protein carbonyl, serum IL-1ß, IL-6, and TNF-α. The decreased effects of EH on IL-1ß and TNF-α were more pronounced than that of the probiotic. Treatments EH and probiotic also de-regulated the mRNA levels of MAPK1, 3, 6, and 14. Listeria acidophilus exhibits a similar effect to EH against L. monocytogenes in rabbits, and the regulation on inflammatory process is via MAPK family genes. The results suggest that L. acidophilus can be used as a feed additive against L. monocytogenes infection.(AU)

Foods introduced into Brazil through the border with Argentina and Uruguay: Pathogen detection and evaluation of hygienic-sanitary quality.

This study aimed to evaluate the presence of pathogens in, and the hygienic-sanitary quality of, commercialized foods of animal origin at the international border region of Rio Grande do Sul, Brazil. In total, 270 samples of raw and processed foods of animal origin were collected in Paso de los Libres, Argentina (n = 65 raw meat, n = 47 dairy products, n = 28 processed meat) and Rivera, Uruguay (n = 60 raw meat, n = 31 dairy products, n = 29 processed meat), or were seized by the Brazilian International Agricultural Surveillance System (Brazil-Argentina border) (n = 9 raw meat, n = 1 bush meat). The samples were subjected to the enumeration of aerobic mesophilic bacteria, enterobacteria, and coagulase-positive staphylococci, and were tested for Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:H7. The virulence genes for Salmonella spp. (hilA, invA, spvC, pefA, and sefA), L. monocytogenes (prs, inlA, inlC, and inlJ) and E. coli O157:H7 (uspA, eae, rfbO157, fliCH7, stx1, stx2, and hlyA) were investigated using PCR assays. Raw products showed higher counts of aerobic mesophiles and enterobacteria compared to processed products (P < 0.05). There were no significant differences in aerobic mesophile or in enterobacterial counts between identical products according to origin (Argentina vs. Uruguay, P > 0.05). Escherichia coli O157:H7 was not detected in any of the samples tested. Salmonella spp. was detected in six (8%) raw products from Argentina. Listeria monocytogenes was isolated from five (6.66%) raw products originating in Argentina and 20 (16.66%) raw products from Uruguay. All 52 E. coli isolates carried the uspA gene, but only one carried the eae gene. The rfbO157, fliCH7, stx1, stx2, and hlyA genes were not detected. All Salmonella spp. isolates carried hilA and invA genes, but spvC, pefA, and sefA were not found. All L. monocytogenes isolates carried the prs gene; however, inlA, inlC, and inlJ genes were found in 20% of the isolates from Argentina and 95% of those from Uruguay. To our knowledge, this is the first microbiological study into the hygienic-sanitary quality of animal products in Brazil's land border region. Salmonella spp. and L. monocytogenes were detected in products of animal origin, constituting a public health concern and emphasizing the need for an active surveillance system to reduce the risk of foodborne pathogen introduction into Brazil.

Lactobacillus spp. impair the ability of Listeria monocytogenes FBUNT to adhere to and invade Caco-2 cells.

OBJECTIVES: The objective of this study was to evaluate the ability of Lactobacillus curvatus CRL705, CRL1532, and CRL1533 and Lactobacillus sakei CRL1613 to survive under simulated gastrointestinal conditions. Moreover, a microencapsulation approach was proposed to improve gastrointestinal survival. Finally, experiments were performed to demonstrate that Lactobacillus spp. can modulate the ability of Listeria monocytogenes FBUNT to adhere to and invade Caco-2 cells. RESULTS: Lactobacillus strains were encapsulated in alginate beads to enhance the survival of bacteria under in vitro gastrointestinal conditions. All strains hydrolyzed bile salts using chenodeoxycholic acid as a substrate and adhered to Caco-2 cells. Cell-free supernatants (CFSs) showed antimicrobial activity against L. monocytogenes as demonstrated by agar diffusion assays. The average percentages of L. monocytogenes adhesion decreased from 67.74 to 41.75 and 38.7% in the presence of 50 and 90% (v/v), respectively, for all CFSs tested. The highest concentrations of CFSs completely inhibited the L. monocytogenes invasion of Caco-2 cells. CONCLUSIONS: The studied Lactobacillus strains have protective effects against the adhesion and invasion of L. monocytogenes FBUNT. Alginate encapsulation of these bacteria improved gastrointestinal tolerance such that they could be further studied as potential probiotics against intestinal pathogenic bacteria.

Biofilm-producing ability of Listeria monocytogenes isolates from Brazilian cheese processing plants.

The persistence of Listeria monocytogenes in food industry environments has been associated to the ability of specific isolates to produce biofilms. This study aimed to evaluate the biofilm production of 85 L. monocytogenes strains previously isolated from samples of cheese, brine and the environment of two cheese processing plants located in São Paulo, Brazil. The L. monocytogenes isolates belonged to serotypes 4b, 1/2b and 1/2c, yielded 30 different pulsotypes by pulsed-field gel electrophoresis (PFGE), and were submitted to biofilm-formation assays on polystyrene microplates and stainless steel coupons incubated statically at 35±0.5°C for 48h. All isolates from different sources showed ability to produce biofilms on polystyrene microplates, from which 21 (24.7%) also produced biofilms on stainless steel. Four isolates (4.7%) belonging to four different pulsotypes were classified as strong biofilms-producers on polystyrene microplates, while isolates belonging to four pulsotypes previously evaluated as persistent had weak or moderate ability to produce biofilms on polystyrene microplates. No relationship between the serotypes or pulsotypes and their biofilm-forming ability was observed. This study highlights the high variability in the biofilm production among L. monocytogenes strains collected from cheese and cheese-production environment, also indicating that strong biofilm-formation ability is not a key factor for persistence of specific isolates in cheese processing plants.

Effect of peracetic acid on biofilms formed by Listeria monocytogenes strains isolated from a Brazilian cheese processing plant

ABSTRACT This study aimed to investigate the effect of peracetic acid (PAA, 0.5%) on adherent cells of three strains of Listeria monocytogenes strains belonging to serotypes 4b and 1/2b that had been previously isolated from the environment of a Brazilian cheese plant. The assays were conducted using polystyrene microplates and stainless steel coupons and the adhered cells were treated with PAA for 60, 120 and 180 s. On stainless steel, biofilms were partially inactivated by PAA after 60 s and almost 100% of the cells were damaged within 180 s using epifluorescence microscopy with LIVE/DEAD® staining. On polystyrene microplates, PAA decreased (P<0.05) biofilm biomass produced by the three L. monocytogenes isolates at 60 s, when compared with controls (no PAA treatment). However, PAA did not completely eliminate L. monocytogenes cells on polystyrene microplates (decreasing 1.8-2.5 log cycles after treatment with PAA for 180 s). The correct concentration and contact time of PAA is critical for eliminating biofilms formed by L. monocytogenes on stainless steel surfaces, although further studies are needed for defining efficient PAA treatments to remove adherent cells of this pathogen on plastic polymers

Antimicrobial effect of ethanol extract of leaf neem (Azadirachta indica A. Juss) on Listeria monocytogenes

Listeria monocytogenes es un patógeno causante de enfermedades alimentarias. En la búsqueda de controlar su propagación utilizando sustancias naturales se planteó el objetivo de mostrar si el extracto etanólico foliar de neem (Azadirachta Indica A. Juss.) tiene efecto antimicrobiano sobre L. monocytogenes ICTA-12446. El extracto se obtuvo a partir de hojas de neem sometidas a secado por 8 días, se redujeron de tamaño mecánicamente, se sometieron a maceración en frío por 3 días usando etanol 96% en recipientes ámbar, se filtró y concentró en rota evaporador. Se estandarizó el concentrado con dimetilsulfóxido (DMSO) a una concentración de 60 mg/L. Listeria monocytogenes ICTA-12446, fue inoculado en caldo nutriente junto con soluciones del extracto a diferentes concentraciones (20, 30, 40, 50 y 60 mg/L), se emplearon tiempos de contacto (2.5, 5, 10 y 15 minutos). Cumplido cada tiempo se realizaron diluciones seriadas e inocularon en agar nutritivo por extensión durante 24 h a 37ºC. Se efectuó el recuento en Unidades Formadoras de Colonias UFC. Al comparar las concentraciones del extracto se evidencia entre 20 y 60 mg/mL diferencia significativa, mientras que en 30, 40 y 50 mg/mL un comportamiento similar. Al contrastar tiempos de contacto, se observa que entre el tiempo 2.5 min y los restantes un p=0,03. El tiempo mínimo donde existió inhibición fue 2.5 minutos, y concentración mínima inhibitoria de 20 mg/mL. Los cuatro tiempos de contacto arrojan porcentajes de inhibición microbiana de 100% al emplear 60mg/mL. Se concluye que el extracto etanólico foliar de neem posee un efecto inhibitorio sobre Listeria monocytogenes(AU)

Listeria monocytogenes is a pathogen causing foodborne illness. In seeking to control its spread using natural substances in order to show if the leaf ethanol extract of neem (Azadirachta indica A. Juss) has antimicrobial effect on L. monocytogenes ICTA-12446, was proposed. The extract was obtained from neem leaves, which was subjected to drying for 8 days. It was reduced in size mechanically, and subjected to cold soak for 3 days, using 96% ethanol in amber vessels, filtered and concentrated in rot evaporator. Concentrated was solubilized with dimethylsulfoxide (DMSO) and standarized to achieve a concentration of 60 mg/mL Listeria monocytogenes was inoculated in nutrient broth with extract solutions at different concentrations (20, 30, 40, 50 and 60mg/mL), four contact times (2.5, 5, 10 and 15 minutes) were used. Completed each time it was diluted and inoculated on nutrient agar by extension for 24h at 37ºC. The count of Colony Forming Units UFC was taking. Comparing the concentrations of the extract between 20 and 60mg /mL significant difference was appreciate, while 30, 40 and 50 mg/mL show a similar behavior. Contrasting contact times observed between time 2.5 min and the remaining p = 0.03. The minimum time where there was some kind of inhibition was 2.5 minutes, and minima inhibitory concentration of 20mg/mL. The four contact times yield microbial inhibition percentages of 100% by using 60mg/L. It is concluded that ethanol extract of neem leaf has an inhibitory effect on L. monocytogenes(AU)

Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries.

Different methods to quantify Listeria monocytogenes biofilms cells showed different profile in their viability.

Listeria monocytogenes is a foodborne pathogen able to adhere and to form biofilms in several materials commonly present in food processing plants. The aim of this study was to evaluate the resistance of Listeria monocytogenes attached to abiotic surface, after treatment with sanitizers, by culture method, microscopy and Quantitative Real Time Polymerase Chain Reaction (qPCR). Biofilms of L. monocytogenes were obtained in stainless steel coupons immersed in Brain Heart Infusion Broth, under agitation at 37 °C for 24 h. The methods selected for this study were based on plate count, microscopic count with the aid of viability dyes (CTC-DAPI), and qPCR. Results of culture method showed that peroxyacetic acid was efficient to kill sessile L. monocytogenes populations, while sodium hypochlorite was only partially effective to kill attached L. monocytogenes (p < 0.05). When, viability dyes (CTC/DAPI) combined with fluorescence microscopy and qPCR were used and lower counts were found after treatments (p < 0.05). Selective quantification of viable cells of L. monocytogenes by qPCR using EMA revelead that the pre-treatment with EMA was not appropriate since it also inhibited amplification of DNA from live cells by ca. 2 log. Thus, the use of CTC counts was the best method to count viable cells in biofilms.

Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance.

Different methods to quantify Listeria monocytogenes biofilms cells showed different profile in their viability

Listeria monocytogenes is a foodborne pathogen able to adhere and to form biofilms in several materials commonly present in food processing plants. The aim of this study was to evaluate the resistance of Listeria monocytogenes attached to abiotic surface, after treatment with sanitizers, by culture method, microscopy and Quantitative Real Time Polymerase Chain Reaction (qPCR). Biofilms of L. monocytogenes were obtained in stainless steel coupons immersed in Brain Heart Infusion Broth, under agitation at 37 °C for 24 h. The methods selected for this study were based on plate count, microscopic count with the aid of viability dyes (CTC-DAPI), and qPCR. Results of culture method showed that peroxyacetic acid was efficient to kill sessile L. monocytogenes populations, while sodium hypochlorite was only partially effective to kill attached L. monocytogenes (p < 0.05). When, viability dyes (CTC/DAPI) combined with fluorescence microscopy and qPCR were used and lower counts were found after treatments (p < 0.05). Selective quantification of viable cells of L. monocytogenes by qPCR using EMA revelead that the pre-treatment with EMA was not appropriate since it also inhibited amplification of DNA from live cells by ca. 2 log. Thus, the use of CTC counts was the best method to count viable cells in biofilms.

Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG, R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.(AU)

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.